DNA Subsequence A DNA sequence is a sequence of some combination of the characters A (adenine), C (cytosine), G (guanine), and T (thymine) which correspond to the four nucleobases that make up DNA. Given a long DNA sequence, it is often necessary to compute the number of instances of a certain subsequence. For this exercise, you will develop a program that processes a DNA sequence from a file and, given a subsequences, searches the DNA sequence and counts the number of times s appears. As an example, consider the following sequence: GGAAGTAGCAGGCCGCATGCTTGGAGGTAAAGTTCATGGTTCCCTGGCCC If we were to search for the subsequence GTA, it appears twice. You will write a program (place your source in a file named dnaSearch.c) that takes, as command line inputs, an input file name and a valid DNA (sub) sequence. That is, it should be callable from the command line as follows: /dnaSearch dna01.txt GTA GTA appears 2 times