Question: Hello, I am currently working on Python. Q: Write a function called start_codon which accepts a DNA sequence as its argument and returns the first

Hello,

I am currently working on Python.

Q: Write a function called start_codon which accepts a DNA sequence as its argument and returns the first codon as a string. Assume the sequence is in frame.

My code so far is:

start_codon("ATGGACTGACTTTAGGCC") def start_codon(dna): StartCod = dna[0:3] StringOfCodon=StartCod.split(",") print(StringOfCodon) #return StringOfCodon #print(str(start_codon("ATGGACTGACTTTAGGCC"))) I keep getting an error for "start_codon undefined".

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

PYTHON." Write a function called start_codon which accepts a DNA sequence as its argument and returns the first codon as a string. Assume the sequence is in frame." I'm new to python and can't really...

1. Write a function called start_codon which accepts a DNA sequence as its argument and returns the first codon as a string. Assume the sequence is ATGGAACCAACGTCAGTGACTTCGTCAG"

please try to answer parts 3,7&8 especially using python 2.7. my code is not working and this is due today. verify using working test codes. Basically I am stuck with the longestORF non reading (part...

Finding genes in DNA is a fundamental problem in biology. After all, only a few percent of human DNA actually contains protein-coding genes. Sifting through the more than 3 billion base pairs to find...

First part is already done here is the link...

Answer in python 2.7 please . I am really struggling with this and i really would love your help. Its due today and i am especially stuck on question 3 which builds on from the other codes like...

im stuck with writing a working code for those in python: Using python, how do I write a function called countCodons(DNA) which takes an input a DNA string (you may assume its length is a multiple of...

NO PLAGIARISM, NO PLAGIARISM, NO PLAGIARISM!!!! PYTHON AND USE CS50 IDE https://cs50.harvard.edu/x/2021/psets/6/dna/ DNA Implement a program that identifies a person based on their DNA, per the...

2. Crypto In contrast with the small isolated exercises you have been doing so far, the goal of this assignment is to give you the opportunity to create something a little larger and more complex....

General Instructions Create a new notebook named HW_05_YourLastName.ipynb and complete problems 1 - 8 described below. Download the files diamonds_partial.txt and titanic_partial.txt , placing them...

The difference between total receipts and total payments is referred to as cash balance. net cash flow. cumulative cash flow. beginning cash flow.

Triec, Inc., is a small electrical contracting company in Springfield, Ohio, owned by its executives, Yeazell, Jones, and Heaton. Employees contacted the International Brotherhood of Electrical...

An Allowable Business Investment Loss, if unused after 2 0 years, reverts back to a net capital loss carryforward. Question 1 2 options: TrueFalse

Compared with half a century ago, adoption has become _ _ _ _ _ _ _ _ _ common, but it is more open and acceptabl e , so we probably discuss it _ _ _ _ _ _ _ . fill in the blanks more or much less or...

15-3 What are the challenges posed by global information systems and management solutions for these challenges?

15-4 What are the issues and technical alternatives to be considered when developing international information systems? 15-1 What major factors are driving the

2. Use the web to research the company, its products, services, and customers, and the way it operates. Think about what the company needs to do to expand sales globally.