Question: HELP URGENT PYTHON CODE PLEASE A very early step in splice site recognition is exon definition, a process that is as yet poorly understood. Communication

HELP URGENT

PYTHON CODE PLEASE

A very early step in splice site recognition is exon definition, a process that is as yet poorly understood. Communication between the two ends of an exon is thought to be required for this step. Computational discovery of the exon-intron border or the intron-exon border or the transcription factor binding sites (TFBS) is a challenging but important problem of bioinformatics. Implement a software application for DNA motif finding by following the steps below.

A total of 9 known motif sequences are given:

HELP URGENT PYTHON CODE PLEASE A very early step in splice site

These sequences represent the exon-intron boundary.

1. make the count matrix

2. make the weight matrix

3. make the relative frequencies matrix

4. make the Log-likelihoods Matrix

recognition is exon definition, a process that is as yet poorly understood.

5. Analize sequence S by using the Log-likelihoods Matrix:

S="CAGGTTGGAAACGTAATCAGCGATTACGCATGACGTAA" Calculate the score for each sliding window. Do you have signals indicating that the S sequence contains an exon-intron border?

\begin{tabular}{c|cccccccccc} & 1 & 2 & 3 & 4 & 5 & 6 & 7 & 8 & 9 \\ \hdashline & 1 & G & A & G & G & T & A & A & A & C \\ \cline { 1 - 13 } & T & C & C & G & T & A & A & G & T \\ 3 & C & A & G & G & T & T & G & G & A \\ 4 & A & C & A & G & T & C & A & G & T \\ 5 & T & A & G & G & T & C & A & T & T \\ 6 & T & A & G & G & T & A & C & T & G \\ 7 & A & T & G & G & T & A & A & C & T \\ 8 & C & A & G & G & T & A & T & A & C \\ 9 & T & G & T & G & T & G & A & G & T \\ 10 & A & A & G & G & T & A & A & G & T \end{tabular}

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!