Question: help with these please 1. In a BCC structure (see below schematic), a=0.35 nm, the atomic weight of the material is 141 g/mol, Avogadro constant

help with these please

1. In a BCC structure (see below schematic), a=0.35 nm, the atomic weight of the material is 141 g/mol, Avogadro constant is 6.023x10 atoms/mol, answer the following questions (6 points). M 1.1. Draw a [127] direction (1 point). 1.2. Draw a (210) plane (1 point). 2 2 1.3. Calculate the theoretical density of the material (4 points)

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Chemical Engineering Questions!

I want to know if my answers are correct to the questions i answered. I have provided the question along with the answers please review them and make changes if it is wrong. I. In a BCC structure...

please solve this question it has three parts and i want to make sure i get correct answer. do not copy and paste answer on chegg or i will downvote In a BCC structure (see below schematic), a = 0.35...

help with these please Question-3. Given that Pt has an FCC crystal structure, density (P) = 21.45 g/cm', atomic mass (An) = 195.084 g/mol, Avogadro constant (NA) * 6.022 * 102 atoms/mol. Calculate...

1. Carol has been asked to assist her company's HR Manager in creating a new performance management system. She is excited to learn more about performance management, but is having trouble...

Hw3.seq TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC Need help with assignment please. 1. The genetic code of any organism consists of three nucleotides, also referred to as codon. Many...

I have a question regarding a problem that is done in "DrRacket" . (Please don't answer in a different programming language, it doesn't help me at all!) ............................................

I REALLY NEED HELP ON 6&7 ONLY PLEASE!! Landis Apparel Co. Ruth Landis was carefully considering the firms sales prospects for 2016. Her firm, located in Southern California, did slightly over $100...

PLease help me with the journal entires no i am not emailing homeworkhelp89 to pay 3$ a journal I pay chegg for you to help me so please 1. Pledges amounting to $200,000 were received. Of this...

Need help with this please. 1 Submission Instructions Create a document using your favorite word processor and type your exercise solutions. At the top of the document be sure to include your name...

HELP IN JAVA PLEASE !!!!! 1 Whats my GPA? For the first part of this lab, youre going to be writing a Java program that computes GPA based on input from a user. Specifically, wed like a user to be...

Indicate which project would be selected if the net present value is used Indicate which project would be selected if the internal rate of return is used Indicate which criteria you would suggest...

a ab, a-b, a+b Above shows real numbers that belong to an arithmetic progression in order. Find the next term of this sequence.

Motor controllers serve as the motor ON / OFF function. True False

CoursHeroTranscribedText: Suppose that the resistance in the circuit shown is 3x10" Q. A voltage is applied to the circuit and then is suddenly removed at time t=0. The measured voltage across the...

In the clusters chart, click the individual with the highest number of transactions. What is the category or supplier group with the highest number of transactions?

Hover over the individuals in the Benford Average visualization (you could also create a new visualization to show the Benford average and Purchase Order count by user). What is the name of the...

How does cluster analysis help you easily identify those outliers?