================================================================================

Here is Problem Four:

And the data mention in Problem Four is as follow:

Please Help, thank you!

Problem Five: In this problem, you are going to take the program you wrote for Program Four, and add to it instructions (lines of code) to create a new file, that you name "GC_content.txt", that contains the DNA strings and their corresponding GC content. Name your new program hw1_5.py. For example: The first line of the file "GC_content.txt" should be: ATCGCTCGTGATCGTAGATAGGATTTCGAGAT:43.75 Do not forget to use the Python Coding Style conventions. Problem Four: Writing Multiple FASTA File [Page 68] Use the data from the previous exercise, but instead of creating a single FASTA file, create three new FASTA files - one per sequence. The names of the FASTA files should be the same as the sequence header names, with the extension "fasta". Name your program writing_multiple_fasta_files.py. For example: ABC123.fasta, DEF456.fasta, and GHI789.fasta. Do not forget to use the Python Coding Style conventions. Sequence header ABC123 DEF456 GHI789 DNA sequence ATCGCTCGTGATCGTAGATAGGATTTCGAGAT gtcgttogtagctaaagcttgtcgatgcgctcgctag CTCGTAGT-ATCTT--ATTAG----CACTGAT Do not forget to use the Python Coding Style conventions