Question: how many possible reading frames this is mRNA contain? 5' AGTCGTGATCAGTAC 3'

how many possible reading frames this is mRNA contain?

5' AGTCGTGATCAGTAC 3'

Step by Step Solution

★★★★★

3.36 Rating (146 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

The detailed answer for the above question is provided below Step 1 of 2 Reading Fram... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Q:

How many frames of reference does the stay-at-home twin experience in the twin trip? How many frames of reference does the traveling twin experience?

Q:

How many different sequences of mRNA could encode a peptide with the sequence proline-glycine-methionine-serine?

Q:

How many possible samples of size 5 are possible from a population of size 70?

Q:

explain this: 1 8 . ( 2 ) The sequence from somewhere in the middle of an mRNA is 5 - UACUCUCGGCACUGG - 3 . How many possible reading frames are in this piece of mRNA? A . One B . Two C . Three D ....

Q:

How many possible reading frames are there on a single strand of DNA? 3 6 1 2

Q:

Problem Statement: This question asks to write a script to obtain all protein sequences coded in the human genome in the multiple FASTA format, using the RefSeq table obtained from the UCSC Table...

Q:

please try to answer parts 3,7&8 especially using python 2.7. my code is not working and this is due today. verify using working test codes. Basically I am stuck with the longestORF non reading (part...

Q:

Hw3.seq TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC Need help with assignment please. 1. The genetic code of any organism consists of three nucleotides, also referred to as codon. Many...

Q:

BIOCHEMISTRY. everyone has answered this incorrectly at this point. please solve according to directions. please answer with certainty. if there was more info it would be attached already An open...

Q:

The sequence of a gene in Drosophila melanogaster that encodes a histone H2A polypeptide is as follows:...

Q:

Yang Corp. is growing quickly. Dividends are expected to grow at a rate of 29 percent for the next three years, with the growth rate falling off to a constant 6.3 percent thereafter. The required...

Q:

Healthcare information technology has been promoted by researchers, the government, and others as increasing the quality of patient care. How is this assumption supported? Provide a list and a...

Q:

During 2 0 2 2 Maxwell purchased 1 0 0 bonds of Malinois Inc. at par for $ 9 0 0 , 0 0 0 . Maxwell purchases debt securities expecting to ear profits on short - term differences in price and holds...

Q:

What is the absolute difference in your total concentration of iodine in the CH2Cl2 phase, in mol/L, between your 'best two' determinations in Part 2 of the experiment? Use your own lab-obtained...

Q:

Develop a change management strategy Develop a change management strategy for the business. You can use an organisational template if you have one or you can use the Change Management Strategy...

Q:

Virginia Co . has a subsidiary in Hong Kong and in Thailand. Assume that the Hong Kong dollar ( HK$ ) is pegged at $ 0 . 1 2 per Hong Kong dollar and it will remain pegged. The Thai baht fluctuates...

Q:

Question 4 Financial Instruments (14 marks) On 30 June 2018 Magoo Ltd issued 50 000 convertible notes with a face value of $50 million for a term of five years. Each note was convertible at the...

Q:

How much more interest will be earned if $5000 is invested for 6 years at 7% compounded continuously, instead of at 7% compounded quarterly?

Q:

There are at least 20 different types of myosin. What properties do all types share, and what makes them different? Why is myosin II the only myosin capable of producing contractile force?

Q:

While investigating the function of a specific growth factor receptor gene from humans, researchers found that two types of proteins are synthesized from this gene. A larger protein containing a...

Q:

The Calvin cycle reactions that fix CO 2 do not function in the dark. What are the likely reasons for this? How are these reactions regulated by light?

Q:

A manager wishes to estimate a population mean using a 95% confidence interval estimate that has a margin of error of 44.0. If the population standard deviation is thought to be 680, what is the...

Q:

One of the reasons for multiple car accidents on highways is thought to be poor visibility. Recently, the National Transportation Agency (NTA) of the federal government sponsored a study of one rural...

Q:

A sample size must be determined for estimating a population mean given that the confidence level is 90% and the desired margin of error is 0.30. The largest value in the population is thought to be...