I need a python code, thank you

1. Coding exercise on BioPython simple sequence operations, chapter 2-3 (25 points). Use the DNA sequences "GAATCTATCATATATGAGAAGATATTTACTCAA" and "CCATTGTCTTAAACCGACITATCTTTTCTGCTTGTAGA" and do the following: Make a seq object out of each and then count the number of A's in each and the GC content. Concatenate the sequences and first reverse complement the concatenated result, and then transcribe and translate it. Use two different translation table options, and observe the difference in the resulting protein sequence