I need some guidance with diagraming the DNA replication process, I have notes so I can understand the process

Below is a piece of dsDNA with the 5 and 3 directions labeled for each strand. - the highlighted and underlined pair of nucleotides represent an origin of replication 5'-GCTTACTTGGATAAGCATGGCATAGCTT'TTATCGGCGCCTCCGTACACGGTACGATCGCACGCCTCGTGAG-3' 3' - CGAATGAACCTATTCGTACCGTATCGAAAAATAGCCTCGCGGAGGCATGTGCCATGCTAGCGTGCGGAGCACTC-5' Instructions: 1) Use the dsDNA above to diagram the process of DNA replication. You may illustrate the process using whatever materials you would like. You may use the steps defined in lecture to guide your diagram, or you may parse the process in whatever way you feel logical. However, note the required information in the following steps. 2) Required information: -for each step you define, provide a written description of what is happening at that point in the process -identify what protein machinery is involved and what function it provides - label the leading and lagging strands -clearly differentiate whether there is DNA or RNA present -clearly indicate where nucleotides are covalently connected or not yet bonded 3) Assume that: -the origin is centered at the highlighted and underlined pair of nucleotides (between the two) -primase puts down a 5 base pair primer each time -each Okazaki fragment is 15 base pairs in length -the DNA ends at the end of the segment shown