I need this done in java code please ill rate fast

5. Suppose we are interested in studying a DNA sequence which consists of four bases: A,C,G, and T. For example: TGCGTGCTACCACATCATGCAGTTTTCAAAGAAGAAAGCCTCACCACAAA. (a) Write a function of the form String getRandDNA (int n ) which creates a random string of length n. (b) Write a function of the form int getBasecount (string dna, char base), where dna [ ] is a DNA string and base is a single character. The function returns how many times base occurs in the string. For example, in the above string, ' T ' occurs 10 times. Note: Here, you don't have to pass in the array dimension because you can get it from the strlen function