I saved the sequence and used:

[Header, SEQ] = fastaread('lexA.dat.txt')

to read the sequence in Matlab. It can be downloaded from [ http://arep.med.harvard.edu/ecoli_matrices/dat/lexA.dat ]

Needed help with Rsequence(l)

>dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca >lexA-2 7->27 aactgtatatacacccaggg >polB(dinA) 53->73 gactgtataaaaccacagcc >recA 59->79 tactgtatgagcatacagta >recN-1 49->69 tactgtatataaaaccagtt >recN-2 27->47 tactgtacacaataacagta >recN-3 9-29 TCCTGTATGAAAAACCATTA >ruvAB 49->69 cgctggatatctatccagca >sosC 18->38 tactgatgatatatacaggt >sosD 14->34 cactggatagataaccagca >sulA 22->42 tactgtacatccatacagta >umuDC 20->40 tactgtatataaaaacagta >uvrA 83->103 tactgtatattcattcaggt >uvrB 75->95 aactgtttttttatccagta >uvrD 57->77 atctgtatatatacccagct

Rsequence(1) = 2-(H (I) + e(n)) where H(!) =- p(b, l)log2(1)(b,l)) and b E A, C, G, T and I is the position of the se- quence. So, you may ask "What is e(n)?" Well, we are going to set e(n) 0 and see how our magnitude of our sequence logo differs from the Berkeley Weblogo for the same sequence Find the Rsequence) where is each position in the sequence. Plot tis Rcquence vs. I. Also, make a b x I table of the base information, bi per l/ position. Print this table out. (Remember the bi =P(b,1)Rsequence(1)). Rsequence(1) = 2-(H (I) + e(n)) where H(!) =- p(b, l)log2(1)(b,l)) and b E A, C, G, T and I is the position of the se- quence. So, you may ask "What is e(n)?" Well, we are going to set e(n) 0 and see how our magnitude of our sequence logo differs from the Berkeley Weblogo for the same sequence Find the Rsequence) where is each position in the sequence. Plot tis Rcquence vs. I. Also, make a b x I table of the base information, bi per l/ position. Print this table out. (Remember the bi =P(b,1)Rsequence(1))