Question: import edu.duke.*; public class CodonFinder { private int countCodons(String dnaIn, String codonIn){ String dna = dnaIn.toLowerCase(); int count = 0; int lastIndex = 0; String

import edu.duke.*;

public class CodonFinder { private int countCodons(String dnaIn, String codonIn){ String dna = dnaIn.toLowerCase(); int count = 0; int lastIndex = 0; String findStr = codonIn.toLowerCase(); while ((lastIndex = dna.indexOf(findStr, lastIndex)) != -1) { count++; lastIndex += findStr.length(); } return count; } private float cgRatio(String dnaIn){ String dna = dnaIn.toLowerCase(); int count = 0; int lastIndex = 0; String findStr = "c"; while ((lastIndex = dna.indexOf(findStr, lastIndex)) != -1) { count++; lastIndex += findStr.length(); } // save c count float cCount = count; //reset count and index lastIndex = 0; count = 0; findStr = "g"; while ((lastIndex = dna.indexOf(findStr, lastIndex)) != -1) { count++; lastIndex += findStr.length(); } float gCount = count; return (cCount/gCount); } private int findStartIndex(String dna,int index){ //standardize dna to lower case //dna.toLowerCase(); int start = dna.toLowerCase().indexOf("atg", index); return start; } private int findStopIndex(String dnaIn, int index){ //first standardize DNA to lowercase String dna = dnaIn.toLowerCase(); int stopTga = dna.indexOf("tga", index); if(stopTga == -1 || (stopTga-index)%3 != 0){ stopTga = dna.length(); } int stopTag = dna.indexOf("tag", index); if(stopTag == -1 || (stopTag-index)%3 != 0){ stopTag = dna.length(); } int stopTaa = dna.indexOf("taa", index); if(stopTaa == -1 || (stopTaa-index)%3 != 0){ stopTaa = dna.length(); } return Math.min(Math.min(stopTag, stopTga), stopTaa); } private void printGenes(StorageResource store){ StorageResource longDna = new StorageResource(); StorageResource cgDna = new StorageResource(); int maxLengthOfGene = 0; for (String dna: store.data()){ if (dna.length()>60){ longDna.add(dna); } if(cgRatio(dna)>0.35){ cgDna.add(dna); } if(dna.length() > maxLengthOfGene){ maxLengthOfGene = dna.length(); } } System.out.println("The following " +longDna.size()+ "genes have more than 60 nucliotides:"); //for (String dna: longDna.data()){ // System.out.println(dna); //} System.out.println("The following " +cgDna.size()+ "genes have a C/G Ratio of higher than 0,35:"); //for (String dna: cgDna.data()){ // System.out.println(dna); //} System.out.println("The longest gene has the length: " +maxLengthOfGene); } private StorageResource storeAll(String dna){ int index = 0; StorageResource store = new StorageResource(); while (true){ int startCodonIndex = findStartIndex(dna,index); if (startCodonIndex == -1){ break; } int endCodonIndex = findStopIndex(dna, startCodonIndex+3); if ((((endCodonIndex+3)-startCodonIndex) % 3 == 0 )&&endCodonIndex != dna.length()){ if(endCodonIndex == dna.length()){ store.add(dna.substring(startCodonIndex, endCodonIndex)); index = endCodonIndex; }else{ store.add(dna.substring(startCodonIndex, endCodonIndex+3)); index = endCodonIndex+3; } } else{ index = startCodonIndex+3; } } return store; } private void printAll(String dna){ int index = 0; while (true){ int startCodonIndex = findStartIndex(dna,index); if (startCodonIndex == -1){ break; } int endCodonIndex = findStopIndex(dna, startCodonIndex+3); if (((endCodonIndex+3)-startCodonIndex) % 3 == 0){ System.out.println(dna.substring(startCodonIndex, endCodonIndex+3)); index = endCodonIndex+3; }else{ index = startCodonIndex+3; } } } public void testFinder(){ //String dna = "ATGTGCAACCCGGGTTTAAAATAAGTTCCCAAATTTTTAA"; //String dna = "ATGAAATGAAAA"; //String dna = "ccatgccctaataaatgtctgtaatgtaga"; String dna = "CATGTAATAGATGAATGACTGATAGATATGCTTGTATGCTATGAAAATGTGAAATGACCCA"; System.out.println("DNA string is:"); System.out.println(dna); System.out.println("Gene found is: "); //printAll(dna); StorageResource store = storeAll(dna); for (String gene: store.data()){ System.out.println(gene); } } public void testStorageFinder(){ FileResource dnaFile = new FileResource("brca1line.fa"); String dna = dnaFile.asString(); //String dna = "CATGTAATAGATGAATGACTGATAGATATGCTTGTATGCTATGAAAATGTGAAATGACCCA"; StorageResource store = storeAll(dna); System.out.println("There are " +store.size()+ " potential genes in the data."); printGenes(store); System.out.println("The codon CTG appear in a strand of DNA the following times: " + countCodons(dna, "CTG")); } public void testCGRatio(){ String dna = "ATGAACACCTGA"; System.out.println("DNA string is:"); System.out.println(dna); float result = cgRatio(dna); System.out.println("The C to G Nocliotide Ratio is: " +result); } }

brca1line.fa

I don't know why it won't open a file up.

FileResource: cannot access brca1line.fa

the file resource method is not finding the file

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!