Question: In C++ Implement Brute Force Median String Search algorithm [No need to use a tree]. Test the given algorithm for the cases of 4-mer, 5-mer

In C++

Implement Brute Force Median String Search algorithm [No need to use a tree]. Test the given algorithm for the cases of 4-mer, 5-mer and 6-mer with the given Sequences.fa file.

Test Case 1:

For sequences in Sequences.fa, the motif of length = 4 is GATC

Test Case 2: For sequences in Sequences.fa, the motif of length = 5 is CCGAA

Test Case 3: For sequences in Sequences.fa, the motif of length = 6 is TCCGAA

Sequence .fa

>1 TAGTGGTCTTTTGAGTGTAGATCTGAAGGGAAAGTATTTCCACCAGTTCGGGGTCACCCAGCAGGGCAGGGTGACTTAAT >2 CGCGACTCGGCGCTCACAGTTATCGCACGTTTAGACCAAAACGGAGTTGGATCCGAAACTGGAGTTTAATCGGAGTCCTT >3 GTTACTTGTGAGCCTGGTTAGACCCGAAATATAATTGTTGGCTGCATAGCGGAGCTGACATACGAGTAGGGGAAATGCGT >4 AACATCAGGCTTTGATTAAACAATTTAAGCACGTAAATCCGAATTGACCTGATGACAATACGGAACATGCCGGCTCCGGG >5 ACCACCGGATAGGCTGCTTATTAGGTCCAAAAGGTAGTATCGTAATAATGGCTCAGCCATGTCAATGTGCGGCATTCCAC >6 TAGATTCGAATCGATCGTGTTTCTCCCTCTGTGGGTTAACGAGGGGTCCGACCTTGCTCGCATGTGCCGAACTTGTACCC >7 GAAATGGTTCGGTGCGATATCAGGCCGTTCTCTTAACTTGGCGGTGCAGATCCGAACGTCTCTGGAGGGGTCGTGCGCTA >8 ATGTATACTAGACATTCTAACGCTCGCTTATTGGCGGAGACCATTTGCTCCACTACAAGAGGCTACTGTGTAGATCCGTA >9 TTCTTACACCCTTCTTTAGATCCAAACCTGTTGGCGCCATCTTCTTTTCGAGTCCTTGTACCTCCATTTGCTCTGATGAC >10 CTACCTATGTAAAACAACATCTACTAACGTAGTCCGGTCTTTCCTGATCTGCCCTAACCTACAGGTCGATCCGAAATTCG

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

3. Implement the Brute Force Median String Search algorithm [No need to use a tree]. Test the given algorithm for the cases of 4-mer, 5-mer and 6-mer with the given Sequences.fa file. (60 points]...

File Searching Homework CSS 162 : Programming Methodology Assignment by Rob Nash Recursively Searching Files & Directories Summary Build a class and a driver for use in searching your computers...

All code must be written in C++ (C++ was also used in CS1, CS2, and CS3). You should submit The source codes. A document showing the output for test cases. Put all the individual files in one single...

Can you do only question 3 please All code must be written in C++ (C++ was also used in CS1, CS2, and CS3). You should submit The source codes. A document showing the output for test cases. Put all...

In Java lang This lab consists of the following sections: Submit the outcome of your Lab work as *.java files with comments on the lab solutions for the following segments: Designing Recursion...

For Q2, test case2, the pattern should be 'AAAAAA'. C++ please. 1. Implement a function to compute the Hamming Distance between two DNA sequences. The function needs two DNA sequences as inputs. The...

C++ please 1. Implement a function to compute the Hamming Distance between two DNA sequences. The function needs two DNA sequences as inputs. The output should be the Hamming distance between the two...

ol (a) This question concerns the data structure of queues. (i) Describe the primitive queue operations. [3 marks] (ii) Describe an efficient implementation of queues, presenting code fragments as...

Homestead Pottery, Inc., is divided into two operating divisions: pottery and retail. The company allocates power and human resources department costs to each operating division. Power costs are...

Sunnyvale Loan Company is in the consumer loan business. Sunnyvale borrows from banks and loans out the money at higher interest rates. Sunnyvales bank requires Sunnyvale to submit quarterly...

1 . An investor who has a stock anticipates earning \ ( 8 \ % \ ) on that investment. That earning is a A . Market rate B . Systematic return C . Risk premium D . Real return E . Expected return

Jane Doeis being registered for snon - ESRD service. She has medicare A & B , Aetna HMO through a spouce who works for a large group & an AaRP supplement. Which is primary

=+ Should the MNE belong (why, why not)?

=+What does membership entail, do most employers join, and can the firm avoid joining?

=+ What is the role of government in bargaining?