In cpp

jects/project 02.html Task A: Transcription Each gene codes for a protein, and transcription is the first step of gene expression. Most protein synthesis occurs in organeles known as ribosomes, which are located outside of the nucleus where DNA is stored. To relay information to a ribosome, the cell makes a copy of the relevant gene fronm DNA and sends that copy out of the nucleus. The copy is called a messenger ribonucleic acid, or mRNA. Like DNA, mRNA is made of the same nucleobases, except for one: it does not contain thymine [T), but insteed contains uracil |UJ That means that the complement of IA] in mRNA is [UJ As such, the rules of complementation in mRNA are as follows . [A] becomes (U IT] becomes [A] . [C] becomes (G . [G] becomes (C] Your task is to write a program called transcriptase epp that reads a daa txt that contains one DNA strand per line, which looks as follows AAGATCCCG CCGTAAGATGCOGTA and outputs to the console (terminal) the corresponding mRNA strands. Each output line must contain exactly one mRNA strand. This is a sample output of the program s/transeriptase Recall that to read from a file, the following oode snipet can be used ifstream fin( dna.txt" it (tin.failo) Corr "Pile cannot be read, opened, or does not exist.in exit(l)3 sering strandi vhile(gotlinectin, strand)) ex strand 4 andl tin.elosec) [C] becomes (G (G] becomes (C Your task is to write a program called transcriptase.cpp that reads a text file called dna.txt that contains one DNA strand per line, which looks as follows: AAGATGCCG ATGCCGTAAGATGCGGTAAGATGC CCCTAAGATCCCGTA and outputs to the console (terminal) the corresponding mRNA strands. Each output line must contain exactly one mRNA strand. This is a sample output of the program: s./transcriptase GGCAUUCUACOGCAU Recall that to read from a fle, the following code snipet can be used: ifstrean fin("dna.txt) it in.tyi ( cerr "ile cannot be read, opened, or does not exist.In exit(1)i string strand vhile(getline(fin, strand)) ( coutstrand