Question: In the genetic code some amino acith are not specified by any codons. some codons sercify more than one amino acid. some codons consint of

In the genetic code
some amino acith are not specified by any codons.
some codons sercify more than one amino acid.
some codons consint of the nucleotides.
many amino acids are specifed by more than one codon.
In the genetic code some amino acith are not

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Q:

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

Q:

Some protein sequences evolve more rapidly than others. But how can this be demonstrated? One approach is to compare several genes from the same two species, as shown for rat and human in the table....

Q:

C++ Your assignment is to build an application that can read a file of nucleotides into a linked list. 1. The file contains a sequence of nucleotides (G, C, A, T). 2. The file will always contain a...

Q:

Need help with 1.3. 1 The genetic code (Number systems) The blueprints for life are stored in DNA molecules, which are made up of strings of monomer building blocks. There are 4 distinct monomers,...

Q:

in python please ! a string consisting purely of nucleotides by first removing the in and then all the newline characters. You'll need to do the following to find all the occurrences of the...

Q:

The DNA molecule is made up of two linked strands which together form a helix. The links between the strands are provided by bonds between pairs of chemicals called bases . There are four such bases,...

Q:

Hw3.seq TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC Need help with assignment please. 1. The genetic code of any organism consists of three nucleotides, also referred to as codon. Many...

Q:

Need help with writing a script for the assignment in the picture Assignment 6 Overview In this assignment, your program will simulate protein synthesis from DNA. Specifically, it reads a DNA string...

Q:

1. The discussion of abstraction in Section 1.3.1 noted that one does not need to understand the makeup of the components as long as "everything about the detail is just fine." The case was made that...

Q:

Practical electronics strongly favors binary representations for encoding information (two-state; 0 or 1). In DNA, biology uses a quaternary representation of four different nucleobases (four-state;...

Q:

How does the balanced scorecard concept help guide logistics managers in the development of a performance measurement system?

Q:

Alliance Software began 2011 with accounts receivable of $115,000. All sales are made on credit. Sales and cash collections from customers for the year were $780,000 and $700,000, respectively. Cost...

Q:

A hazard ratio of 0 . 7 6 indicates a Group of answer choices risk increase of 7 6 % risk increase of 2 4 % risk reduction of 2 4 % risk reduction of 0 . 7 6 %

Q:

I Really Need Help Please Helpp !! Please Show Formulas and Use Excel! . 7. Agency Costs Fountain Corporation's economists estimate that a good business environment and a bad business Page 552 en...