Question: In the longest palindrom substring (or longest sysmmetric factor), the goal is to find the maximum-length contiguous substring in a given text which is

In the longest palindrom substring (or longest sysmmetric factor), the goal is

In the longest palindrom substring (or longest sysmmetric factor), the goal is to find the maximum-length contiguous substring in a given text which is also a palindrome. A palin- dromic word refers to a ward or a phrase that reads the same in both directions, i.e, when it is read in forward and reverse directions. Examples of palindromes are strings "civic", "racecar", and "aibohphobia". Consider the following DNA sequence: "AGCTTTTCCCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGGTTCTGAACTGGTT ACCTGCCGTGAGTAAATTAAAATATTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCAGACAGATAAAAA" Explain how to use a code for LCS to find the longest palindrome of any sequence. Provide the code that implements your solution. This code should use your previous LCS code as a function. If we consider the above DNA sequence as a text sequence, report the output of your palindrome code applied on this sequence (provide both the palindrome substring and its length).

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

To find the longest palindrome substring of a given sequence you can adapt the Longest Common Subseq... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Algorithms Questions!

Consider the following data for farmer John who sells tomatoes in a perfectly competitive market. Assume the current market price of tomatoes is $8.00 per bushel, and costs change with quantity as...

Verify that u (vw)=uvu w = for (a1, b, c), = (a2, b2, C2), and w = (a3, b3, C3). This is the Distributive Law for the dot product.

The Millers are thinking of introducing a new product line in their store. For this exercise, assume the following: Total fixed costs for the line are estimated at $15,000. Total number of units...

An air-conditioner with a power input of 1.2 kW is working as a refrigerator ( = 3) or as a heat pump ( = 4). It maintains an office at 20C year round which exchanges 0.5 kW per degree temperature...

Holding Up Under Stress. A string or rope will break apart if it is placed under too much tensile stress [Eq. (11.8)]. Thicker ropes can withstand more tension without breaking because the thicker...

Determine the maximum height h in meters to which the girl can walk up the slide without supporting herself by the rails or by her left leg. The coefficient of static friction between the girl?s...

A fish tank 16-in by 27-in by 14-inch deep is carried in a car which may experience accelerations as high as 6 m/s2. Assuming rigid-body motion, estimate the maximum water depth to avoid spilling....

The laminar-draining flow from Prob. 10.12 may undergo transition to turbulence if Re > 500. If the pavement slope is 0.0045, what is the maximum sheet thickness, in mm, for which laminar flow is...

A bond issued by Standard Oil worked as follows. The holder received no interest. At the bonds maturity the company promised to pay $1,000 plus an additional amount based on the price of oil at that...

Determine the maximum value of load current at which regulation is maintained for the circuit of Fig. 15.47. 805 OUT (+5 V) 200 F 0.01F Bridge rectifier FIG. 15.47 Problem 25

From the accompanying purchases journal, record in the accounts payable subsidiary ledger and post to general ledger accounts as appropriate. PURCHASES JOURNAL Page 1 Accounts GST Post. Payable...

Annual sinking fund payments made at the beginning of every year for six years, earning 11.5% compounded annually, amount to $25 000 at the end of six years. Construct a sinking fund schedule showing...

5 rep Es x Step E step Step E Stee Gast Sees Question 1 7 of 2 0 Which statement is true regarding thromboembolic events? Thromboembolic events are rarely life threatening. Chronic conditions are...

Zambia Pastry uses a periodic inventory system. Its records show the following for the month of May, in which 70 units were sold. Compute the ending inventory at May 31 using the FIFO and the LIFO...

The management of Muni Corp. is considering the effects of various inventory costing methods on its financial statements and its income tax expense. Assuming that the price the company pays for...

RooPhone Inc. uses the product cost concept of applying the cost-plus approach to product pricing. The costs of producing and selling 5,000 units of cellular phones are as follows Variable costs...

A firm faces uncertain revenues and uncertain costs. Its revenues may be $120,000, $160,000, or $175,000, with probabilities .2, .3, and .5, respectively. Its costs are $150,000 or $170,000 with...

In its first month of operations Rusch BBQ made three purchases of sausages in the following sequence: (1) 300 pounds at $6, (2) 400 pounds at $7, and (3) 200 pounds at $8. Assuming there are 450...

Clairaut's Theorem for f(x,y) is fxy=fyx. Similarly, what must be true about Clairaut's Theorem for f(x,y,z)?Select all answers that are correct.

Describe how to compute shiftHash(h(X[i..i+m1]), X, i) for the hash function, h(X[i..i + m 1]) = X[i] + + X[i + m 1], where each character is viewed as an integer in the range [0, c 1], with c...

Suppose you are given a connected weighted undirected graph, G, with n vertices and m edges, such that the weight of each edge in G is an integer in the interval [1, c], for a fixed constant c > 0....

The problem of accurately summing a set S of n floating-point numbers, S = {x 1 , x 2 ,...,x n }, on a real-world computer is more challenging than might first appear. For example, using the standard...

30. What is one major diff erence between olfactory receptors and those of the vomeronasal organ?

1. How could you determine whether hypnosis releases endorphins?

7. What kinds of sounds most strongly activate the auditory cortex?