Java Prrogramming code:

Please write the data processing methods, such as codon() and codon2aa() in a separate Java class, and the input and output in another class. (include comments)

1. Please develop a Java program to read in a piece of DNA sequence from a FASTA format sequence file (hwk1.seq) (data from hwk1.seq pasted at bottom actually file link could not be pasted in)(alternatively you can use the getRandomSeq(long) method of the RandomSeq class to generate a piece of DNA sequence, and then print out all the codons in three forward reading frames. Design a method called codon() that can be used to find all the codons from three reading frames. The method will take in an argument, the reading frame (1, 2, or 3), and return an array or ArrayList with all the codons. All the codons should have three nucleotides, please discard the last one if it does not have three nucleotides.

hwk1.seq contains the sequence

TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC 

2. Please add another method called codon2aa() to modify the previous program (question #1) to print the corresponding amino acid beneath each codon. Use a single letter representation of the amino acid, and a * for the stopping codon.