Question: Lab Exercise - Practical 0 8 - part 2 Question 1 : By using the provided sequence, identify the similar sequence that is manually curated

Lab Exercise

-

Practical

08 -

part

2

Question

1

By using the provided sequence, identify the similar sequence that is manually curated using the default algorithm on BLAST and answer the questions accordingly.Provide the sequence ID or accession ID for the sequence with lowest E value.What does the sequence code for?What is the function of the coded protein?Which organism produce it

?

What can vou conclude if this protein is found within a human?

Lab Exercise - Practical 08- part 2 Question 1: By using

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Lab Exercise - Practical 0 8 - part 1 Question 1 : Using the primary databases from NCBI website, search for mRNA and protein sequence of insulin. Identify and list the information required below: \...

This is aproject for digital logic can you please solve Part F and Part G this a Digital logic mini project A. Objectives The objectives of this laboratory are to introduce the students to The...

Lab Exercise - Practical 8 - part 1 By using a manually generated dot plot, align the provided sequences and calculate their scores accordingly: a ) Sequence A: TCAACTGAGTTCTGTTTAATG Sequence B:...

Complete class diagram (phase 5 and 6). 17 Questions. 17 To be submitted: 18 Marking Criteria. 20 Appendix A: Sample Output for a completed phase 6. 22 Objectives In this assignment you will develop...

Please give the answer of question 2 Question 1. Provide short answers (i.e., no more than five lines on average with the font size of 12) for the following items. The grade for each item is 5...

I need the following homework exercise completed. All of the information is within the attached files. I require no explanations, just the answers. Part 1: Finding information: Each of the following...

Kindly provide answer and supporting workings for Qn 1b & Qn 3a,3b for ACC217. ACC217 Accounting Information Systems Assignment 2 - Group-based Assignment January 2017 Presentation ACC217 Assignment...

Nay programming languge is fine (MatLab, Octave, etc.) This is the whole document this last picture i sent is the first page 5. Write and save a function Sphere Area that accepts Radius as input...

b. Based on the below state diagram of a circuit to detect the sequence 1011. Answer the following questions: [2 marks] S2 Zei Z=0 1. Draw and fill the state table of the circuit. 2. Write the...

Briefly describe ASCII and Unicode and draw attention to any relationship between them. [3 marks] (b) Briefly explain what a Reader is in the context of reading characters from data. [3 marks] A...

You are about to take the road test for your driver's license. You hear that only 34% of candidates pass the test the first time, but the percentage rises to 72% on subsequent retests. Estimate the...

In a manufacturing process, a long coated plastic rod (p = 2200 kg/m J c = 800 J/kg K, k =1 W/m K) of diameter D = 20 mm is initially at a uniform temperature of 25C and is suddenly exposed to a...

? _ _ _ _ _ _ _ _ _ b l a n k a r e o n l i n e s e r v i c e s t h a t u s e a l g o r i t h m s t o a u t o m a t i c a l l y p e r f o r m m a n y i n v e s t m e n t t a s k s d o n e b y a h u m...

5. Develop a scenario comparing two PH programs and involving the use of a CBA.

8. Should public employees have the same right to strike as private-sector employees are granted under the Labor Management Relations Act? Why or why not?

1. Was Williams entitled to have a witness at the meeting with Harless, Gray, and Fisher? Explain. TerryWilliams is an employee at a unionized plant in Memphis, Tennessee. Williams is a member of and...

4. What proof does the Company have that the Grievant did what he was accused of? On March 27, 1998, the Company, the Union, and Mr. Danny Webb, the Grievant, entered into and signed the following...