Need help with this code in C++ using only string functions and the simplest as possible

As well as using namespace std;

Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3 and the gene does not contain any of the triplets ATG, TAG, TAA, and TGA. Write a program that prompts the user to enter a genome and dis- plays all genes in the genome. If no gene is found in the input sequence, the pro- gram displays no gene is found

- The first gene has to be 3 long

- The second has to be 6 long

- The third has to be 9 long and so on Some sample outputs would be: Enter the genome: TTATGTTTTAAGGATGGGGCGTTAGTT Output: TTT GGGCGT

(Bioinformatics:find genes) Biologists use a sequence of letters A,C, T, and G to modela genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3 and the gene does not contain any of the triplets ATG,TAG, TAA, and TGA. Write a program that prompts the user to enter a genome and displays all genes in the genome. If no gene is found in the input sequence, displays no gene. Here are the sample runs: Enter a genome string: TTATGTTTTAACGATCCGGCGTTAGTT e GGGCGT Enter a genome string: TGTGTGTATAT t no gene is found