Question: Notice that the sequence provided below is in FASTA format, i . e . , it does not start directly with nucleotide abbreviations ( A

Notice that the sequence provided below is in FASTA format, i.e., it does not start directly with nucleotide abbreviations (A, G, T, C), nor it does include numbers, spaces or symbols. Instead, a name or designation for the sequence is written in the first line, preceded by the ">" symbol.
Start by scanning (by eye) the given sequence (4560-bp) in search of the location of the following short nucleotide stretches. Devise your own method.
i) CATTTCGTGTGGATCGCTCCTTTGCAAGTG and ii) TTTAGAGAGAAGGCTGTCCTTAGTACCAGA
 Notice that the sequence provided below is in FASTA format, i.e.,

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!