Question: Notice that the sequence provided below is in FASTA format, i . e . , it does not start directly with nucleotide abbreviations ( A
Notice that the sequence provided below is in FASTA format, ie it does not start directly with nucleotide abbreviations A G T C nor it does include numbers, spaces or symbols. Instead, a name or designation for the sequence is written in the first line, preceded by the symbol.
Start by scanning by eye the given sequence bp in search of the location of the following short nucleotide stretches. Devise your own method.
i CATTTCGTGTGGATCGCTCCTTTGCAAGTG and ii TTTAGAGAGAAGGCTGTCCTTAGTACCAGA
Step by Step Solution
There are 3 Steps involved in it
1 Expert Approved Answer
Step: 1 Unlock
Question Has Been Solved by an Expert!
Get step-by-step solutions from verified subject matter experts
Step: 2 Unlock
Step: 3 Unlock
