p

Please help question 5 for the first part and 3 and 4 for the second part!

7:32 PM Mon Mar 8 68% 4 Bio 3709_DNA Project-1.docx + A B I U A E 1. Develop 3 individual DNA strands that includes all 4 bases and is 40 bases long (include directionality). (6pts) A) 5'ATGCGCTACTAGGCTATGCTTAGCATGCATGCAGTCAGTC3' B) S'ATCTAGTACTAGGCTATGCTTAGCATGCATGCAGTGCGCG3' o C) 5'GCTAGATACTAGGCTATGCTTAGCATGCATGCAGTCGTAG3' 2. From those 3 developed strands determine and list the consensus sequence (include directionality). (2pts) S'TACTAGGCTATGCTTAGCATGCATGCAGT3' 3. The consensus sequence is now your DNA strand that will use for the rest of this activity 4. Determine the complementary strand with correct basc pairing and include directionality for both strands. (Labcl strands: template & complementary) (&pts) A) 3'TACGCGATGATCCGATACGAATCGTACGTACGTCACGCGCS B) 3TAGATCATGATCCGATACGAATCGTACGTACGTCACGCGCS' C) 3'CGATCTATGATCCGATACGAATCGTACGTACGTCAGCATCS 5. Show the first 6bp of your DNA going through 1 round of semi-conservative replication. (Use different colors to represent parent and new strands) (6pts) RNA: 1. List the 3 stages of Transcription. (3pts) A) Initiation B) Elongation C) Termination 2. Transcribe your template strand into an RNA strand with correct base pairing and directionality. (Keep in mind the direction in which DNA is transcribed) (opts) S'TACTAGGCTATGCTTAGCATGCATGCAGT3-DNA S'UACUAGGCUAUGCUUAGCAUGCAUGCAGU3' 3. Process your RNA strand by removing 2 introns (totaling 20bp), joining the cxons, and adding a Poly-A lail. (10pts) 4. What RNA strand did you just make? (2pts) and in the 7:32 PM Mon Mar 8 68% 4 Bio 3709_DNA Project-1.docx + A B I U A E 1. Develop 3 individual DNA strands that includes all 4 bases and is 40 bases long (include directionality). (6pts) A) 5'ATGCGCTACTAGGCTATGCTTAGCATGCATGCAGTCAGTC3' B) S'ATCTAGTACTAGGCTATGCTTAGCATGCATGCAGTGCGCG3' o C) 5'GCTAGATACTAGGCTATGCTTAGCATGCATGCAGTCGTAG3' 2. From those 3 developed strands determine and list the consensus sequence (include directionality). (2pts) S'TACTAGGCTATGCTTAGCATGCATGCAGT3' 3. The consensus sequence is now your DNA strand that will use for the rest of this activity 4. Determine the complementary strand with correct basc pairing and include directionality for both strands. (Labcl strands: template & complementary) (&pts) A) 3'TACGCGATGATCCGATACGAATCGTACGTACGTCACGCGCS B) 3TAGATCATGATCCGATACGAATCGTACGTACGTCACGCGCS' C) 3'CGATCTATGATCCGATACGAATCGTACGTACGTCAGCATCS 5. Show the first 6bp of your DNA going through 1 round of semi-conservative replication. (Use different colors to represent parent and new strands) (6pts) RNA: 1. List the 3 stages of Transcription. (3pts) A) Initiation B) Elongation C) Termination 2. Transcribe your template strand into an RNA strand with correct base pairing and directionality. (Keep in mind the direction in which DNA is transcribed) (opts) S'TACTAGGCTATGCTTAGCATGCATGCAGT3-DNA S'UACUAGGCUAUGCUUAGCAUGCAUGCAGU3' 3. Process your RNA strand by removing 2 introns (totaling 20bp), joining the cxons, and adding a Poly-A lail. (10pts) 4. What RNA strand did you just make? (2pts) and in the