Part 1: Loading the Database and Finding Matches Write a Java program to read in the dataset of the DNA data from a text file. Your program should ask which text file to use for the database. Then it should continually prompt the user for a DNA String and output either who in the database it matches or No Match if there is not a match. The progri should quit if a user types Q for the DNA string. A sample output is provided below if the file were: File nome, AGAT, AATG, TATC Alice, 5,2,8 Bob, 3,7,4 Charlie, 6,1,5 Output What file has the DNA datobase? sinaliSanple,txt AATGCCAATAGACAAA The sequence matches Alice. The sequence natches Bob. ATCTATCTATCTATCTATCAACCCCTAG The sequence natches NO MATCH. Two different files are included for testing with different numbers of STRs included. Your program should work for any database that is formatted as specified, no matter the number of STRs included. Part 2: Finding Close Matches in the Case of No Exact Match Sometimes we are not using DNA testing to determine if it came from the same person, instead we are looking for close matches which might represent. family. Add to your program so that if there is no match, it identiftes the closest match (if there is a tie for the closest match, show all matches) and prints how close they are. The closeness of a match is determined by the number of STRs that are the same. So given the sample fle above. if the DNA string had 5 AGATs, 2 AATGs and 4 TATCs. Alice would be closest with 2 STRs matching, then Bob with 15TRs matching and finally Charlie with no STRs matching. So the output would only show Alice as the closest match. If the DNA string had 5 AGATs, 7 AATGs, and 7 TATCs, the Alice and Charlie woulc be tied for closest with 1 matching STR each. Sample output for these are shown below Output What file has the bKh dotobase? srallsorple, tat What is the 0aA String of type Q to quit? AGATAGATAGATAGATAGATAATGAATGTATCTATCTATCTATC The sequence matches No MaTch. Closest Matches are: Alice With 2 STRs in common What is the oNA String or type Q to quit? AGATAGATAGATAGATAGATAATGAATGAATGAATGAATGATGAATGTATCTATCTATCTATCTATCTATCTATC The sequence matches No Mifich. Closest Matches are: Alice With 1 STRs in comon Notes For this assignment, you will work in a two-person team with your partner assigned by the instructor. The purpose of this assignment is to refamiliarize you with Java programming and identify any holes in your knowledge/skills. You may not consult with classmates or persons outside your team lother th the instructor, of course). You must demonstrate good programming style when completing this assignment, including the appropriate use of Javadoc-sty comments for all classes and methods. The interface for your program is entirely up to you. It need not be fancy. but it must at least allow the user to ent the file names and view the results. I have provided the details for the constructor and 3 methods that need to be implemented. Any other methods/classes you want to add are up to you and you should use these methods in the Driver class. Here is some starter code: httos: / classroom.github.com/a/AEZ24xik B