When we look at valuing a company, we take many factors into consideration. If a company...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
When we look at valuing a company, we take many factors into consideration. If a company has acquired a firm or merged this will ultimately affect the valuation. Mergers and acquisitions can add value if it was successful". a) Evaluate the concept of mergers and acquisitions and how they can add value to a firm. Include real life examples of value creation through M&A's. (30 marks) b) Suggest why companies merge and acquire and discuss your reasons in detail. (20 marks) c) Evaluate the role and importance of confidentiality agreements/non-disclosure agreements in M&A negotiations. (10 marks) Students are expected to develop the theory covered in class, research examples and evaluate the findings. PART B- INVESTMENT APPRAISAL DIAZ ple has been researching three investment proposals. Details of the cash flows of each proposal are as follows: Year 1 Year 2 Year 3 Year 0 Capital Invested Proposal A (€200,000) 120,000 80,000 80,000 B (E800,000) 500,000 440,000 140,000 (€1,600,000) 950,000 850,000 350,000 Diaz ple has €2m available for investment and has a cost of capital of 12%. a) Calculate the optimum combination of investments Diaz ple should invest in assuming that the projects are divisible b) Discuss ways in which Diaz ple may alternatively address the proposals on the basis that the projects are non-divisible When we look at valuing a company, we take many factors into consideration. If a company has acquired a firm or merged this will ultimately affect the valuation. Mergers and acquisitions can add value if it was successful". a) Evaluate the concept of mergers and acquisitions and how they can add value to a firm. Include real life examples of value creation through M&A's. (30 marks) b) Suggest why companies merge and acquire and discuss your reasons in detail. (20 marks) c) Evaluate the role and importance of confidentiality agreements/non-disclosure agreements in M&A negotiations. (10 marks) Students are expected to develop the theory covered in class, research examples and evaluate the findings. PART B- INVESTMENT APPRAISAL DIAZ ple has been researching three investment proposals. Details of the cash flows of each proposal are as follows: Year 1 Year 2 Year 3 Year 0 Capital Invested Proposal A (€200,000) 120,000 80,000 80,000 B (E800,000) 500,000 440,000 140,000 (€1,600,000) 950,000 850,000 350,000 Diaz ple has €2m available for investment and has a cost of capital of 12%. a) Calculate the optimum combination of investments Diaz ple should invest in assuming that the projects are divisible b) Discuss ways in which Diaz ple may alternatively address the proposals on the basis that the projects are non-divisible
Expert Answer:
Answer rating: 100% (QA)
Answer Explanation PartA a iAcquisition When one entity acquiror entity takes over another entity acquiree entity and establishes itself as the new owner such process of take over is known an acquisit... View the full answer
Related Book For
Statistics for Management and Economics Abbreviated
ISBN: 978-1285869643
10th Edition
Authors: Gerald Keller
Posted Date:
Students also viewed these accounting questions
-
Year 1 Year 2 Year 3 Accounting Income (loss) $150,000 $330,000 $(550,000) A Capital Asset was purchased on January 1 of year 1 at a cost of $90,000. Depreciation is $15,000 per year. CCA is $17,000...
-
Year 1 Year 2 Year 3 Accounting Income (loss) $150,000 $330,000 S(550,000) A Capital Asset was purchased on January 1 of year 1 at a cost of $90,000. Depreciation is $15,000 per year. CCA is $17,000...
-
When we look at the Sun, we are seeing it as it was 8 minutes ago. So we can only see the Sun "in the past." When you look at the back of your own hand, do you see it "now" or in "the past"?
-
Review the Financial Statements provided to each group on Blackboard (You may use laptops for this exercise). [ Focus on: a) Is the company Profitable b) Does the company have a lot of liabilities c)...
-
The 2011 annual report of Alaska Airlines contained the following footnote: PROPERTY, EQUIPMENT, AND DEPRECIATIONProperty and equipment are recorded at cost and depreciated using the straight-line...
-
In the manufacture of methyl ethyl ketone from butanol, the product is separated from unreacted butanol by distillation. The feed to the column consists of a mixture of 0.90 mol fraction MEK, 0.10...
-
Heidi Zahn is a human resources manager currently reviewing data on 98 employees. In the data, each observation consists of an employees age and an employees performance rating. a. Heidi applied...
-
Kenton Industrial Corporation uses the weighted-average method in its process costing system. During April, the Baker Assembly Department completed its processing of 18,000 units and transferred them...
-
Your boss (for 1 of the six organizations you have to choose from-Google, Walt Disney Company, Amazon, P&G, 3M, or Ford Motor Company) has asked you to represent the organization in an industry panel...
-
Andrew Jackson's actions in the Seminole War were universally celebrated in Congress and throughout the nation eventually resulted in Spain relinquishing Florida ended in an embarassing series of...
-
What is a language-based learning disability.Discuss the relationship between pragmatic language skills and social difficulties of children with learning disabilities
-
Saying that a quantitative trait exhibits a continuum means that a. the numerical value for the trait increases with the age of the individual. b. environmental effects are additive. c. the...
-
The government has today imposed a price ceiling on gasoline purchased at the pump. As one member of Congress said, It was done to keep gasoline prices within the reach of the poor and the...
-
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
-
With regard to the CRISPR-Cas system that defends bacteria against bacteriophage attack, what happens during the adaptation, expression, and interference phases? When a bacterium is exposed to a...
-
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
-
A ball is in free fall. Its acceleration is: a . upward during ascent and downward during descent b . downward during ascent and upward during descent c . downward during both ascent and descent d ....
-
Frontland Advertising creates, plans, and handles advertising campaigns in a three-state area. Recently, Frontland had to replace an inexperienced office worker in charge of bookkeeping because of...
-
Refer to Exercise 6.89. Suppose that you are told that the drug is effective. What is the probability that the drug taker is a man?
-
Repeat Exercise for the 2009 season. In exercise, the practitioner also recorded the average away attendance for each team in the 2012 season. Because visiting teams take a share of the gate, owners...
-
The number of pizzas delivered to university students each month is a random variable with the following probability distribution. a. Find the probability that a student has received delivery of two...
-
If a random variable has a normal distribution, what are the probabilities that it will take on a value within (a) 1 standard deviation of the mean; (b) 2 standard deviations of the mean; (c) 3...
-
Verify that (a) \(z_{0.005}=2.575\); (b) \(z_{0.025}=1.96\).
-
Given a random variable having the normal distribution with \(\mu=16.2\) and \(\sigma^{2}=1.5625\), find the probabilities that it will take on a value (a) greater than 16.8 ; (b) less than 14.9; (c)...
Study smarter with the SolutionInn App