1. PCR primers have been designed to amplify a 714 base-pair region of the GFP gene from its coding sequence. That sequence is underlined below. Remember, you are only looking at the coding strand of the DNA. Typically, a forward primer includes the first 20-22 bp of the amplified sequence. Which one of the following correctly describes the first EIGHT nucleotides of a FORWARD primer for GFP?

   GAGATATACATATGGCTAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGAT

   GTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTA

   TTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTC

   CCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACT

   ATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTA

   TCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACAC

   AATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGG

   ATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCAT

   TACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTA

   ACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAATGAATTCGAGCTCGGTACCCGGGGATCCTC

   TAGAGTCGA

   
   

   	A.	5’ ATGGCTAG 3’
   	B.	5’ GAGATATA 3’
   	C.	5’ TAGAGCTC 3’
   	D.	All of these listed here could be a successful forward primer.
   	E.	5’ CTAGAGTC 3’

 

Which one of the following correctly describes the first EIGHT nucleotides of a REVERSE primer for the underlined sequence from GFP shown in Question 2?

1. 	A.	5’ CTAGAGTC 3’
   	B.	5’ TAGAGCTC 3’
   	C.	5’ ATGGCTAG 3’
   	D.	5’ GAGATATA 3’
   	E.	All of these listed here could be a successful forward primer.

 

1. Which of the following letters on the diagram below correctly describes where the band would be on a gel after colony PCR with GFP-specific primers was completed from bacteria without the pGLO plasmid grown on LB plates?

   
   

   	A.	A
   	B.	B
   	C.	C
   	D.	D
   	E.	E

 

1. Which of the following letters on the diagram in Question 4 correctly describes where the band would be on a gel after colony PCR with GFP-specific primers was completed from bacteria transformed with the pGLO plasmid grown on LB+amp+arabinose plates?

   	A.	A
   	B.	B
   	C.	C
   	D.	D
   	E.	E

1. You set up PCRs with the GFP primers from colonies of bacteria that were transformed with pGLO and plated on either LB+amp or LB+amp+ara.

   You would expect to see the same result on the gel electrophoresis of your PCR products for the colonies from these 2 plates.

   True

   False