Question: Please answer ( c - e ) in this problem 6 . Design a set of primers to introduce BamHI and HindIII recognition sites at

Please answer (c-e) in this problem
6. Design a set of primers to introduce BamHI and HindIII recognition sites at the 5' and 3' ends, respectively, of the human insulin gene.
Insulin gene:
ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG
BamHI 5'....G GATCC.... 3' HindIII 5'....A AGCTT.... 3'
3'....CCTAG G...5'3'.....TTCGA A...5'
c. Forward primer:
d. Reverse primer:
e. Highlight the sequences targeted by the primers.
Please answer ( c - e ) in this problem 6 .

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!