Question: Please use JAVA to finish this program, thanks! EXERCISE 2: (40 POINTS) This exercise is on the two-finger walking algorithm for ordered lists From the

Please use JAVA to finish this program, thanks! EXERCISE 2: (40 POINTS) This exercise is on the two-finger walking algorithm for ordered lists

Please use JAVA to finish this program, thanks!

EXERCISE 2: (40 POINTS) This exercise is on the two-finger walking algorithm for ordered lists From the link alongside the lab, download the Ordered List class that was discussed in the lectures. Step 1: Write a program that reads a list of names from a file and constructs an ordered list. For example, if the input text file is: Shai Tom Jim Aaron Barbara Beth Fred Jack Jarred Jill Amar Ralph Jill Hillary it should create the following ordered list. Print the contents of the list: [Aaron, Amar, Barbara, Beth, Fred, Hillary, Jack, Jarred, Jill, Jim, Ralph, Shai, Tom] Note: Although Jill is repeated in the input list, the ordered list does not have repeated items

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Hello there. I really need help writing this python code for multiprocessing using the rsync command to fix a slow system. I've posted the question before but I guess I didn't attach enough details,...

Java Programming Assignment - I have attached code below in a download link - Thanks Please do part 1 and/or part 2 Files download : https://files.fm/u/sk5ccu6j Problem Description In this problem we...

This assignment has two exercises, one on unordered lists and one on ordered lists. Download the zip file alongside the assignment link. It contains all the necessary files for you to proceed with...

Please use java to finish this, thx!!! Exercise 1. A prime number, as you know, is a positive integer that has no factors other than 1 and itself. For example, the first six prime numbers are 2, 3,...

Please use java to finish this program. Exercise 1: These are recursive programs discussed in the lectures. a) Fibonacci series 0,1,1,2,3,5,8,13,21,34, ifn-0, then fib(n)=0 //base case if n--1, then...

Please use Java to finish the code, thank! This is similar to the exercise that was discussed in the lectures. However, you need to define two methods, namely, contains and touches, that have...

Please use Java to finish that, thx! The DNA.txt file is like this: GGAGGCCGAGACCAGACGCGGAGCCATGGCCGAGGTGTTGCGGACGCTGG CCGGTGAGTGCAGGCCTCGGCCCCGGGTGCCCGCGAGGGAGCCGCTACCG...

The heap and heapDemo class is in here: import java.util.ArrayList; public class Heap > { ArrayList heapList; public Heap() { heapList = new ArrayList (); } public int size() { return...

Please use java to finish this program, thank you!! Exercise 3. Write a method to multiply two matrices. The header of the method is as follows public static double[ multiplyMatrix (double a, double...

please use Java to finish this problem and write a test function to test it. thanks!!! Implement a class 'Car' with the following properties. A car has a certain fuel efficiency (measured in...

A 30-kg aluminum block initially at 140C is brought into contact with a 40-kg block of iron at 60C in an insulated enclosure. Determine the final equilibrium temperature and the total entropy change...

Rico spends 3 percent of his income on CDs. His uncompensated (standard) price elasticity of demand for CDs is 1.5, and his income elasticity of demand is 2. What is Rico's compensated price...

Select the correct statement regarding flexible budgets. 8 Multiple Choice 2 1 : 1 3 A flexible budget can only be prepared for a single level of activity. A flexible budget shows expected revenues...

Compared with half a century ago, adoption has become _ _ _ _ _ _ _ _ _ common, but it is more open and acceptabl e , so we probably discuss it _ _ _ _ _ _ _ . fill in the blanks more or much less or...

If the tax rate is 40 percent, compute the beforetax real interest rate and the after-tax real interest rate in each of the following cases. a. The nominal interest rate is 10 percent and the...

Assume that the reserve requirement is 20%. Also assume that banks do not hold excess reserves and there is no cash held by the public. The Federal Reserve decides that it wants to expand the money...

It is often suggested that the Federal Reserve try to achieve zero inflation. If we assume that velocity is constant, does this zero-inflation goal require that the rate of money growth equal zero?...