Prepare journal entries dated October 31 to record October production activities for (1) direct materials usage,...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
Prepare journal entries dated October 31 to record October production activities for (1) direct materials usage, (2) direct overhead applied, (4) costs transfer from Shredding to Bagging. (5) costs transfer from Bagging to finished goods, (6) credit sales, and (7) cost of goods sold. A No Transaction 1 B 2 C 3 D 4 E 5 F 6 G 7 General Journal Work in process inventory-Shredding Raw materials inventory Work in process inventory-Shredding Work in process inventory-Bagging Factory wages payable Work in process inventory-Shredding Work in process inventory-Bagging Factory overhead Work in process inventory-Bagging Work in process inventory-Shredding Finished goods inventory Work in process inventory-Bagging Accounts receivable Sales Cost of goods sold Finished goods inventory 000 00 000 00 00 Debit Credit 236,000 236,000 39,000 117,000 156,000 64,350 193,050 257,000 102,000 102,000 572,000 572,000 460,080 460,080 252,000 252,000 Re-Tire produces bagged mulch from recycled tires. Production involves shredding tires and packaging the pieces in the Bagging department. All direct materials enter in the Shredding process. A predetermined overhead rate of 165% of direct labor costs is used in both departments. The following describes production operations for October. Direct materials used (Shredding) Direct labor used (Shredding) Direct labor used (Bagging) Costs transferred from Shredding to Bagging $ 236,000 Costs transferred from Bagging to Finished Goods 39,000 117,000 202,000 572,000 Sales (on credit) for the month total $460,000 and cost of goods sold for the month is $252,000. Prepare journal entries dated October 31 to record October production activities for (1) direct materials usage, (2) direct labor usage, (3) overhead applied, (4) costs transfer from Shredding to Bagging, (5) costs transfer from Bagging to finished goods, (6) credit sales, and (7) cost of goods sold. Prepare journal entries dated October 31 to record October production activities for (1) direct materials usage, (2) direct overhead applied, (4) costs transfer from Shredding to Bagging. (5) costs transfer from Bagging to finished goods, (6) credit sales, and (7) cost of goods sold. A No Transaction 1 B 2 C 3 D 4 E 5 F 6 G 7 General Journal Work in process inventory-Shredding Raw materials inventory Work in process inventory-Shredding Work in process inventory-Bagging Factory wages payable Work in process inventory-Shredding Work in process inventory-Bagging Factory overhead Work in process inventory-Bagging Work in process inventory-Shredding Finished goods inventory Work in process inventory-Bagging Accounts receivable Sales Cost of goods sold Finished goods inventory 000 00 000 00 00 Debit Credit 236,000 236,000 39,000 117,000 156,000 64,350 193,050 257,000 102,000 102,000 572,000 572,000 460,080 460,080 252,000 252,000 Re-Tire produces bagged mulch from recycled tires. Production involves shredding tires and packaging the pieces in the Bagging department. All direct materials enter in the Shredding process. A predetermined overhead rate of 165% of direct labor costs is used in both departments. The following describes production operations for October. Direct materials used (Shredding) Direct labor used (Shredding) Direct labor used (Bagging) Costs transferred from Shredding to Bagging $ 236,000 Costs transferred from Bagging to Finished Goods 39,000 117,000 202,000 572,000 Sales (on credit) for the month total $460,000 and cost of goods sold for the month is $252,000. Prepare journal entries dated October 31 to record October production activities for (1) direct materials usage, (2) direct labor usage, (3) overhead applied, (4) costs transfer from Shredding to Bagging, (5) costs transfer from Bagging to finished goods, (6) credit sales, and (7) cost of goods sold.
Expert Answer:
Posted Date:
Students also viewed these accounting questions
-
On February 1, 2020, Sheridan Company sells merchandise on account to Carla Vista Company for $6490. The entry to record this transaction by Sheridan Company is Sales Revenue Accounts Payable Notes...
-
Incomplete financial statements for Tanner Company are given below: The following additional information is available about the company: a. Selected financial ratios computed from the statements...
-
Write the amino-acid sequence obtained from left-toright translation of the messenger RNA sequence. AUUGGCGCGAGAUCGAAUGAGCCCAGU
-
At December 31, 2017, Seattle Corporation had two notes payable outstanding (notes 1 and 2). At December 31, 2018, Seattle also had two notes payable outstanding (notes 3 and 4). These notes are...
-
General Aviation Company employs six people. Each employee is entitled to three weeks paid vacation every year the employee works for the company. The conditions of the paid vacation are (a) For each...
-
Sales are $2.43 million in 2023, $2.53 million in 2024, and $2.33 million in 2025. What is the percentage change from 2023 to 2024? What is the percentage change from 2024 to 2025? Be sure to...
-
Question 4 (a) Discuss how a balanced scorecard can be successfully implemented in an organization. (10 marks) (b) Select a company of your choice and provide a brief description of its principal...
-
On December 31, 2023, Novak Inc., a public company, borrowed $3 million at 10% payable annually to finance the construction of a new building. In 2024, the company made the following expenditures...
-
Another device Swift uses to develop his satire is hyperbole, or exaggeration, used to emphasize something or to create humor. Identify an example of hyperbole in Swift's essay and explain its...
-
Comfy Toy Company manufactures large and small stuffed animal toys. It has a long - term contract with a large chain of discount stores to sell 3 , 0 0 0 large and 6 , 0 0 0 small stuffed animal toys...
-
Determine the appropriate length of a rail dock (in feet) given the following information. The average railcar loaded is 42 feet long and hold on average 46,000 pounds. The dock needs to support a...
-
In examining the Medicare and Medicare Advantage programs, what are the key elements of the programs and why would you pick 1 over another? Which and why?
-
Coughlan has developed plans to expand into the wholesale flower marketrnand is in the process of negotiating a bank loan to finance the expansion. The bank is requesting 2019 financial statements...
-
The following selected accounts and normal balances existed at year-end. Notice that expenses exceed revenue in this period. Make the four journal entries required to close the books: Accounts...
-
Which of the following is true in the short run? a. MC equals ATC at the lowest point of ATC. b. MC equals AVC at the lowest point of AVC. c. When AVC is at its minimum point, ATC is falling. d. When...
-
Which of the following is true? a. The short-run ATC exceeds the short-run AVC at any given level of output. b. If the short-run ATC curve is rising, the short-run AVC curve is also rising. c. The...
-
When marginal cost is greater than average cost, what happens to the average?
Study smarter with the SolutionInn App