Problem $2(15$ pts$)$: The DNA region shown below encodes a short gene $($a complete gene sequence, including a start codon, an intron, and stop codon$).$ Write out the results of doing each of the following to this sequence $($and label the ends with $5\text{'}$ or $3\text{'},$ N$-$terminus or C$-$terminus$)$:

$5^{\text{'}}-$ TGAGATGCTTTTAGAGCACGTCACTGACAGCGGATGTAAGGAT $-3\text{'}$

$3^{\text{'}}-$ ACTCTACGAAAATCTCGTGCAGTGACTGTCGCCTACATTCCTA $-5\text{'}$

a$)$ Primary mRNA:

b$)$ Mature mRNA:

c$)$ Protein:

d$)$ To get basal expression of this gene, what is required? Draw the genomic DNA and the components that are required for basal expression.

e$)$ Gene expression is regulated in many ways. Choose to either repress the expression of this gene or increase the expression of this gene. Name and describe three different ways that the gene expression can be altered.