Problem Three: Writing a FASTA File [Pages 67-68] FASTA file format is a commonly used DNA and protein sequence file format. A single sequence in FASTA format looks like this: >sequence_name ATCGTAGTCGATGTCGTGTCG where sequence_name is a header that describes the sequence (the greater-than symbol indicates the start of the header line). Often, the header contains an accession number that relates to the record for the sequence in a public sequence database. A single FASTA file can contain multiple sequences, like this: >sequence_one ATCGCTGATGCTAGGATAGCT >sequence_two AGCTGCTGCTCGATCAAACTG >sequence_three AGCTGCTCGTGATATATGCAA Write a program, named writing_a_fasta_file.py, that will create a FASTA file for the following three sequences - make sure that all sequences are in upper case and only contain the bases A, T, G, and C. Sequence header ABC123 DEF456 GHI789 DNA sequence ATCGCTCGTGATCGTAGATAGGATTTCGAGAT gtcgttogtagctaaagcttgtcgatgcgctcgctag CTCGTAGT-ATCTT--ATTAG----CACTGAT Do not forget to use the Python Coding Style conventions