Question: Processing DNA in a File (Page 93) (The text for the problem is shown below.) The file input.txt contains a number of DNA sequences, one

Processing DNA in a File (Page 93) (The text for the problem is shown below.) The file input.txt contains a number of DNA sequences, one per line. Each sequence starts with the same 14 base pair fragment - a sequencing adapter that should have been removed. Write a program that will

(a) trim this adapter and write the cleaned sequences to a new file and

(b) print the length of each sequence to the screen. Download the file here.

Here is the data from the file as well. ATTCGATTATAAGCTCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC ATTCGATTATAAGCACTGATCGATCGATCGATCGATCGATGCTATCGTCGT ATTCGATTATAAGCATCGATCACGATCTATCGTACGTATGCATATCGATATCGATCGTAGTC ATTCGATTATAAGCACTATCGATGATCTAGCTACGATCGTAGCTGTA ATTCGATTATAAGCACTAGCTAGTCTCGATGCATGATCAGCTTAGCTGATGATGCTATGCA

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Programming Questions!

Some Practice Problems for the C++ Exam and Solutions for the Problems The problems below are not intended to teach you how to program in C++. You should not attempt them until you believe you have...

Introduction and learning objectives When you were learning about operational analysis earlier in the term, we talked about jobs that require multiple visits to the CPU (or servers) to receive their...

Portray in words what transforms you would have to make to your execution to some degree (a) to accomplish this and remark on the benefits and detriments of this thought.You are approached to compose...

Some food retailers propose subjecting food to a low level of radiation in order to improve safety, but sale of such "irradiated" food is opposed by many people. Suppose a grocer wants to find out...

The Wilfrid Laurier University bookstore conducts annual surveys of its customers. One question asks respondents to rate the prices of textbooks. The wording is, The bookstores prices of textbooks...

Chromium forms three principal oxides. Write appropriate formulas for these compounds in which the oxidation states of Cr are +3, +4, and +6, respectively.

Identify strategies for preventing and addressing student misbehaviors, including bullying.

Needham Corporation has a $200,000 balloon mortgage payment due in early August. To meet its obligation, it decided on August 1 to accelerate collection of accounts receivable by assigning $260,000...

The Ritz-Carlton has hotels and resorts in the Carribean and Mexico. You are provided with the following budget information for 2020. Suppose that for one of these hotels, management expects...

I bought a car from a dealership and they sold me a stolen car. How do I give the car back and sue them?

While staying at a hotel for a conference, Paulo's supervisor invites him to her room for drinks. When Paulo turns her down, she says he won't be considered for a promotion unless he changes his...

At the aquarium, visitors are asked how much they agree with the statement, "I like jellyfish" from 1 (strongly disagree) to 7 (strongly agree). What scale of measurement is being used? O nominal...

1.) (20 pts) Jobs arrive to a two-station serial line at a rate of 2 jobs per hour with deterministic inter- arrival times. Station 1 has one machine which requires exactly 29 minutes to process a...

Salubrity Plus is a medical equipment supply company with offices and retail locations in Ontario and Qubec. The organization started operations in 2005 and currently has an approximate annual...

A vendor for your part casting claims they redeveloped the casting alloy with less tensile variability. The vendor claims that the new material will show a 20 of 10, 95% of the time. A six sample...

Write a detailed paragraph for a discussion board. Why is collective buying power a pro or advantage for franchising ?

To help you become familiar with the accounting standards, this case is designed to take you to the FASBs Web site and have you access various publications. Access the FASBs Web site at...

39. A deck of n cards, numbered 1 through n, is randomly shuffled so that all n! possible permutations are equally likely. The cards are then turned over one at a time until card number 1 appears....

36. Let p0 = P{X = 0} and suppose that 0 Answered: 1 week ago

38. Let U be a uniform (0, 1) random variable. Suppose that n trials are to be performed and that conditional on U = u these trials will be independent with a common success probability u. Compute...