Question: Program 1. Write a program that prompts the user to enter two strings and reports whether the second string is a substring of the first

Program 1. Write a program that prompts the user to enter two strings and reports whether the second string is a substring of the first string. For Example: Enter string s1: ABCD Enter string s2: BC BC is a substring of ABCD

In java please

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Java Programming Topic: Conditionals and Strings Exercise: Write a program that prompts the user to enter two strings and reports whether the second string is a substring of the first string. I...

Topic: Mathematical Functions, Characters, and Strings Question: (4-22) (Check substring) Write a program that prompts the user to enter two strings and reports whether the second string is a...

Write a program that prompts the user to enter two strings and reports whether the second string is a substring of the first string. Enter string sl: ABCD Enter string s2: BC substring of ABCD -...

Write a program that prompts the user to enter two strings, and reports whether the second string is a substring of the first string. Enter string s1: ABCD Enter string s2: BC BC is a substring of...

4-22) (Check substring) Write a program that prompts the user to enter two strings and reports whether the second string is a substring of the first string. SAMPLE RUN #4: java HasSubstring...

Program 1 Write a program that prompts the user to enter two positive whole numbers as strings! Create a function that validates the input and returns true if all chars in the string are digits. Call...

Problem 5 (18 points) write a C program, called an agrams. c, that prompts the user to enter two strings of characters S1 and S2. and then determines whether these strings are anagrams of each other....

Please use Java to finish that, thx! The DNA.txt file is like this: GGAGGCCGAGACCAGACGCGGAGCCATGGCCGAGGTGTTGCGGACGCTGG CCGGTGAGTGCAGGCCTCGGCCCCGGGTGCCCGCGAGGGAGCCGCTACCG...

Only main method please (Check substring) Write a program that prompts the user to enter two strings and reports whether the second string is a substring of the first string. This program should...

Find the transfer function V (s) V;(s) G(s) = (PO3) V (t) " 1Q www 1H for network 10 + Vo(t)

Refer to PB12-4. Additional Data: a. Prepaid Expenses relate to rent paid in advance. b. Other Operating Expenses were paid in cash. c. An owner contributed capital by paying $200 cash in exchange...

EXERCISE 13-5. Reading the MD&A Section of the Annual Report For a company recommended by your instructor, go to the company's corporate Web site and obtain its annual report (most likely, you will...

how to solve a taxable income between 100,001-225,000 and marginal tax rate is 39%

Discuss issues related to performance-based pay for executives. page 518

Discuss how employee benefits in the United States compare with those in other countries. page 549

List the major factors to consider in matching the pay strategy to the organizations strategy. page 524