Program Behavior: Your program annouces what it does and then prompts for input and output file names. You may assume the user will type the name of an existing input file that is in the proper format. Your program reads the input file to process its nucleotide sequences and outputs the results into the given output file. Notice the nucleotide sequence is output in uppercase, and that the nucleotide counts and mass percentages are shown in A, C, G, T order. A given codon such as GAT might occur more than once in the same sequence. Log of execution: This program reports information about DNA nucleotide sequences that may encode proteins. Input file name? dna.txt Output file name? output.txt Output file output.txt after above execution (partial): Region Name: cure for cancer protein Nucleotides: ATGCCACTATGGTAG Nuc. Counts: (4, 3, 4, 4] Total Mass%: [27.3, 16.8, 30.6, 25.3] of 1978.8 Codons List: ['ATG', 'CCA', 'CTA', 'TGG', 'TAG'] Is Protein?: YES Region Name: captain picard hair growth protein Nucleotides: ATGCCAACATGGATGCCCGATATGGATTG Nuc. Counts: [9, 6, 8, 7] Total Mass%: (30.7, 16.8, 30.5, 22.1] of 3967.5 Codons List: ['ATG', 'CCA', 'ACA, 'TGG', 'ATG", "C

'GAT', 'ATG', 'GAT', 'TGA' ] Is Protein?: YES Region Name: bogus protein Nucleotides: CCATT-AATGATCA-CAGTT Nuc. Counts: [6, 4, 2, 6] Total Mass%: [32.3, 17.7, 12.1, 29.9] of 2508.1 Codons List: ['CCA', 'ITA', 'ATG', 'ATC', 'ACA', 'GT'] Is Protein?: NO Implementation Guidelines, Hints, and Development Strategy: The main purpose of this assignment is to demonstrate your understanding of lists, strings, string manipulations and arrays. Therefore, you should use lists to store the various data for each sequence. In particular, your nucleotide counts and mass percentages should be stored using lists. You will transform the input: from the original nucleotide sequence string to nucleotide counts; from nucleotide counts to mass percentages; and from the original nucleotide sequence string to codon triplets. These transformations are summarized by the following diagram using the "cure for cancer" protein data: Nucleotides: "ATGCCACTATGGTAG" What is computed Output to file These transformations are summarized by the following diagram using the "cure for cancer" protein data: Nucleotides: "ATGCCACTATGETAG" What is computed Output to file Counts: 14, 3, 4, 11 Nuc. Counts: Mas