Question: Question 2 1 . An amino acid can be coded for by more than one codon. This is known as the degeneracy of the genetic

Question 21. An amino acid can be coded for by more than one codon. This is known as the "degeneracy" of the genetic code. How is this possible?
A. There is a tRNA for every alternate codon for the same amino acid
B. Most tRNAs have a wobble position that allows for imperfect pairing
C. The amino acids can be processed in different ways to allow for wobble
D. All tRNAs can change their shape to fit in more than one codon
E. The U in RNA can dynamically change from 2 to 3 H -bonds
Question 2 1 . An amino acid can be coded for by

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Q:

in python please ! a string consisting purely of nucleotides by first removing the in and then all the newline characters. You'll need to do the following to find all the occurrences of the...

Q:

5. (3 marks) Consider the regular expression you devised and tested for Canadian postal codes in Question 2. Using that regular expression, write a python script that will prompt the user for a...

Q:

Problem Statement: This question asks to write a script to obtain all protein sequences coded in the human genome in the multiple FASTA format, using the RefSeq table obtained from the UCSC Table...

Q:

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

Q:

The DNA molecule is made up of two linked strands which together form a helix. The links between the strands are provided by bonds between pairs of chemicals called bases . There are four such bases,...

Q:

6. Amino acids are the structural @# units monomers that make up proteins. They join together to form short polymers chains called peptides or longer chains called either polypeptides or proteins....

Q:

Hw3.seq TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC Need help with assignment please. 1. The genetic code of any organism consists of three nucleotides, also referred to as codon. Many...

Q:

C++ Your assignment is to build an application that can read a file of nucleotides into a linked list. 1. The file contains a sequence of nucleotides (G, C, A, T). 2. The file will always contain a...

Q:

This assignment focuses on arrays and file/text processing. Turn in a file named DNA.java. You will also need the two input files dna.txt and ecoli.txt from below. Save these files in the same folder...

Q:

Multiple choice questions. please provide answers and explanations. 11 2 3 4 5 6 7 III 1 2 3 5 6 7 8 9 10 11 IV O 2 5 6 8 34. What is the most likely mode of inheritance for the genetic trait...

Q:

Write a paper about graduation ceremony at the university Assume you are a consultant who has been approached to deliver your project for the client. Steps here should follow the outline the steps,...

Q:

The concept of accounting income and economic income under the concept of capital conservation?

Q:

Need answer What is the amount of straight- line depreciation for year 3 if the useful life of an asset is 8 years, the purchase price is $72,000, and the salvage value is $8,000

Q:

Sturgis Medical Clinic (SMC) in Sturgis, SD is consideringinvesting in new medical imaging equipment that would increase itscapacity to provide added services to treat patients. The machinewill hav 2...