Question: Question 2: Need CPP code Find all the possible location where a pyrimidine dimmer can be formed in the given template strand. If the DNA

Question 2:

Need CPP code

Find all the possible location where a pyrimidine dimmer can be formed in the given template strand. If the DNA is subject to UV radiations.

TEMPLATE STRAND:

AGTTAGAAGTCTTAGAACCATTAGATTAGAGAAATGCCGCGCGCCGACCATACCATTATTACGCCCCTAGAAGATTAGAGAGAGAACATTATTCGCGCGCCGGAGCCG

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Q:

Question 2: answer any one of them thank you in c++ Find all the possible location where a pyrimidine dimmer can be formed in the given template strand. If the DNA is subject to UV radiations....

Q:

Question 2: KINDLY SOLVE ANY ONE OF THEM IN C++ Find all the possible location where a pyrimidine dimmer can be formed in the given template strand. If the DNA is subject to UV radiations. TEMPLATE...

Q:

Part 1: Planning D Introduction Planning for a project is an important skill, so the TT284 EMA includes an element to encourage you to think about the work you will have to complete, how long the...

Q:

Read this reading properly and create one valuable question after understanding this reading and also answer that question in brief after summarising.Also provide references for this. Reading-...

Q:

Hi I know you opted out of an earlier question. I have several open questions. I really need to get them in. Would you be willing to take any of these questions? I have been waiting for 3 days. I...

Q:

I need to get help with this case study PwC Case Studies in Taxation, 2013, PwC, LLP FLATIRONS, INC. Flatirons, Inc. (dba Flatirons Flapjacks Caf) specializes in unique breakfast and brunch menus and...

Q:

NEED ASAP PLEASE. Deliverables: 1. For each programming question, you must hand in: 1. A cpp source file named A2Q\#[stno].cpp, properly documented. So if your student number is 201234566 and this is...

Q:

*** in java *** worksheet worksheet1.java // Worksheet #1: Stacks import java.io.File; import java.io.IOException; import java.util.ArrayList; import java.util.Scanner; public class...

Q:

CSC240 Programming Assignment #1 PLEASE SEND CODE FOR C++ ON GDBONLINE!!!!! Assigned: Week 1 CSC240 Programming Assignment \#1 Due: Week 2 Points: 50 Review the material from the Gaddis Textbook up...

Q:

machine Learning by networking using javapython programming Criteria Points Part 1 Question 1 Write the code to find the summary statistics and observations based on that. 2 Part 1 Question 2 r...

Q:

Your manager has asked you to develop training materials to help employees understand the role of leadership within your organization. Because there are remote employees in your organization, you...

Q:

Write a program that prompts the user for a wavelength value and prints a description of the corresponding part of the electromagnetic spectrum, as given in Table 7. Table 7 Electromagnetic Spectrum...

Q:

This question is about throwing six dice together and seeing if there is at least one 6. Four learners each threw six dice together a number of times. Here are their results. a Work out the...

Q:

Within a continuously competitive global business environment, publicly held companies face constant pressure to generate and report positive financial results. Unfortunately, some leaders may be...

Q:

3.21 The probability of A is 0.60, the probability of B is 0.40, and the probability of either is 0.76. What is the probability of both A and B?

Q:

3.19 The probability of A is 0.60, the probability of B is 0.45, and the probability of either is 0.80. What is the probability of both A and B?

Q:

3.22 The probability of A is 0.60, the probability of B is 0.45, and the probability of both is 0.30. What is the probability of either A and B?