Question VII $[$String Matching$]$: DNA Sequence Matching. DNA sequences are often represented as strings composed of the characters A$,$ T$,$ G$,$ and C$.$ Given the DNA sequence and pattern below:

Sequence: "ATCGTACGTAGCTAGCGTACGTAGCTAGC"

Pattern: "GTACG"

$(10$ points$)$ Run the KMP Algorithm to find all nonoverlapping occurrences of the pattern in the sequence. show the number of comparisons carried out in each step.

$(2$ points$)$ Explain a practical application of string matching in bioinformatics based on this problem.