Question: questions on second pic Below is the complete sequence of the transcribed region of a gene encoding a plant protein. The introns have been omitted.

questions on second pic

Below is the complete sequence of the transcribed region of a gene encoding a plant protein. The introns have been omitted. ccgagcacca caaaatagag atcaattcac tgacagtcca ccgagatgge taagcggetg gtcctctttg cggcagtagt catcgccctc gtggctctca ccaccgctga aggtgaggcc tctaggcaac tacagtgtga gcgcgagctc caggagaget cgottgaggc atgccggcag gtcgtggacc aacagttggc cggteggctg ccatggagca cggggctcca gatgcgatge toccagcagc tccgagatgt tagcgccaag tgccgctctg tcgccgtcag ccaagtcgca agacaatatg agcaaactgt ggtgccgccc aagggcggat ccttctaccc tggtgagacc acgccactgc agcaactcca acaaggaata ttttggggaa catcttcaca aacagtacaa gggtattacc caagcgtaac ttctcctcgg caggggtcat attatccagg ccaagettet ccacaacage caggacaagg gcaacagcct ggcaaatgge aagaaccagg acaagggcaa caatggtact acccaacttc tctgcagcag ccaggacaag ggcaacagat aggaaaaggg aaacaagggt actacccaac ttctctgcag caaccaggac aagggcaaca aataggacaa gggcaacaag ggtactacco aacttctccg cagcacacag gacaaaggca acaaccagta caagggcaac aaataggaca agggcaacaa ccagaacaag ggcaacaacc aggacaatgg caacaagggt actatccaac ttctccacag cagetaggac aagggcaaca accaggacaa tggcaacaat caggacaagg gcaacaaggg cactacccaa cttctctaca acagccagga caagggcaac aagggcatta cctagettct cagcagcage cagcacaagg gcaacaaggg cactacccaa cttctcagca gcagccagga caagggcaac aagggcacta cccagettet cagcagcage caggacaagggcaacaaggg cactacccag cttctcagca agagccagga caagggcaac aagggcaaat cccagcttct caacagcagc caggacaagg gcaacaaggg cactacccag cttctctgca gcaaccagga caacaagggc attacccaac ttctctacag cagctaggac aagggcaaca aataggacag ccaggacaaa agcaacaacc aggacaaggg caacatecag aacaagggca acaaccagga caagggcaac aagggtacta tocaacttct ccacagcage caggacaagg gcaacaacta ggacaagggc aacaagggta ctacccaact tctccgcagc agccaggaca agggcaacaa ccaggacaag ggcaacaagg gcactgccca acgtccccgc agcagacagg acaagcgcaa caaccaggac aaggccaaca aataggacaa gtgcaacaac caggacaagg gcaacaaggg tactacccaa cttctctgca gcagcctgga caagggcaac agtcaggaca agggcaacag tcaggacaag gacaccaacc aggacaaggg cagcaatcag gacaagagca acaaggetac gacagcccat accatgttag cgcagagcag caagcggcca gcccaatggt ggcaaaggcg cagcagcccg cgacacagct gecgacagtg tgtcggatgg aggggggcga cgcattgtcg getagccagt gatagaactc tctgcagett gcatggtgct tgggcatgca tgcaccttat ctatccaata aacgtgatgc gtgttcacag tttttcatgt aactagagta aaacccaata ataatgcaaa atgaaaagct tctccagcta aaaaagaaca aaatgggtgt tgtatagtat gggt a. What would be the first 10 nucleotides in the mRNA? b. What would be the first 5 amino acids of the protein encoded by this gene? c. Mark the sequences corresponding to the 5'-UTR, open reading frame, 3'-UTR and polyadenylation signal

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Chemical Engineering Questions!

The three forces act on the pipe assembly. If F1 = 50 N and F2 = 80 N, replace this force system by an equivalent resultant force and couple moment acting at O. Express the results in Cartesian...

first pic helps solve questions in second pic. 1 q,r McNeese is determining the staffing level for their credit union located within the university, and has recently hired two tellers (servers). The...

1i,j. first pic helps solve questions in second pic 1 Staffing at the Optimal Utilization A large grocery store is attempting to staff its check-out registers. Currently, the arrival rate is =320...

the first pic is the 1st and 2nd questions, the second pic is the 3rd question. please help me. thank you 6. If the economic benefits from an asset will not be taxable when they are recovered, the...

pls show all working . First pic is the information needed to solve questions in second pic . thank you. cenario 2: A supplier sells a popular auto part to car dealers. The weekly demand is...

2 c,d. first pic helps solve questions in second pic 3 Working with the (Q,R) Model A local paint store uses a (Q,R) inventory system to control its stock levels. For a popular eggshell indoor paint,...

first pic helps solve questions in second pic 1 y,z 3 Working with the (Q,R) Model A local paint store uses a (Q,R) inventory system to control its stock levels. For a popular eggshell indoor paint,...

first pic helps solve questions in second pic 1 u,v A local paint store uses a (Q,R) inventory system to control its stock levels. For a popular eggshell indoor paint, historical data shows the...

firstpic helps solve questions in second pic. 1 s,t McNeese is determining the staffing level for their credit union located within the university, and has recently hired two tellers (servers). The...

Chegg only allows me to upload one picture per question. There are two pictures needed to complete these questions. The picture below is the SECOND PIC and you will need to connect it with the FIRST...

Chegg only allows me to upload one picture per question. There are two pictures needed to complete these questions. The picture below is the FIRST PIC and you will need to connect it with the SECOND...

Lab question. or 3 mL less than the total volume added in the first trial) to save time. 12. Repeat steps 10 and 11. You will have completed three trials after this step. Data Unknown #: 9D Mass of...

Create your own demand curve for a product you buy on a regular basis. Please include a demanding schedule (table with prices and quantity demanded) and label your graph. You can draw it on paper,...

Standard deviation is one of the most common measures of the: Mean return on a security. Volatility of returns over time. Real average rate of return. Risk premium applicable to a security.

CoursHeroTranscribedText: Assume that the company uses the reciprocal method in distributing service department costs and that the Packaging department applies factory overhead based on requisitions....

1. Suppose that there are only three types of fruit sold in the United States. Annual sales are 1 million tons of blueberries, 5 million tons of strawberries, and 10 million tons of bananas. Suppose...

5. True or false: Economists believe that social regulation is an exception to the MB = MC rule because social regulation should in every case extend as far as possible in order to ensure safe...

4. Which of the following is the correct name for the idea that certain firms prefer government regulation because regulation shields them from the pressures of competition and, in effect, guarantees...