S
  1. study help
  2. subject categories
  3. sciences
  4. mathematics
  5. march 2021
  6. 19

Mathematics Questions and Answers March 19, 2021

Expert-verified solutions to help you succeed

the game of mastermind starts in the following way: one player selects three cards from a deck of 52 cards and places them in a line. the second player then tries to guess the sequence of cards. What is the probability of guessing correctly? What if the order of the card does not matter?

The following sequence is an example of: @SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 Group of answer choices FASTQ format GenBank format FASTA format SAM format

Una nevera tiene una capacidad de 400 L. A cuntos galones esta medida equivale? (1 galn = 3.7854 L)

If a researcher found that the margin error=1.0 and the sample mean from the study was 14.8 what is Upper Bound Confidence interval limit

Trying to determine how many boxes of cookies you started the day with. If you've sold 42 but still have 6 remaining What algebraic equation would be used to solve for the number of boxes you started the day with and defining a variable in the equation

The Partial Birth Abortion Ban Act of 2003 defines partial-birth abortion as which of the following: Question 4 options: Abortion utilizing dilation and curettage procedure. Stillbirth Abortion where the fetus is partially expelled while still alive. None of the above

Margot spent $400 this month on propane to heat her home. Her propane company charges $3 per gallon and she received a $20 discount for paying in cash. To determine how many gallons of propane she bought, solve for x in the following equation: 400 = 3x - 20

1. Angle grinders a)Identify one (1) application for angle grinders when completing the waterproofing process b)List two (2) types Angle grinders c)List three (3) pre-operational checks for angle grinders d)List three (3) safety requirements for angle grinders e.g. PPE Briefly describe how to use angle grinders effectively in waterproofing

Simplify (7x2 + 3)(7x2 - 3) using the difference of squares formula. Question 7 options: A) 49x4 - 9 B) 7x2 - 1 C) 49x2 - 9 D) 7x4 - 9

Build a linear regression model to determine the effect of the independent variables in the data set on the amount spent at the store.Because of the limited time for the exam, do not address the issue of heteroscedacity in the data. Linearity assumptions should be checked. Indicate the effect of each independent variable in the yellow cells on
image text in transcribed

\f
image text in transcribed

Which of the following triangles has a circle inscribed? Question 5 options: An image of a triangle whose vertices each lie on a circle. An image of a triangle with a circle inside. An image of a triangle partially contained in a circle. An image of a triangle whose sides are all tangent to a circle

n irreducible polynomial () over is given, along with a particular zero of that polynomial. In each case, express the element as a linear combination of the basis {1, , 2, . . . , 1}. (1) () = 2 + 1 [], = 1 2 (1 + 5); = 5

Translate the following question into an equation (do not solve). 63% of 44 is what number? Question 13 options: 63% = 44 . n 63%. n = 44 63%. 44 = n 63 . 44 = n

Identify the fraction after rationalizing the denominator of -66 . Multiple choice question. 6 66 66 6

A study showed that people who take St. John's Wort daily have a significantly better chance of protecting against depression than those who did not take the vitamin daily. Which of the following statements is/are correct? (5 points) This study provides evidence that taking St. John's Wort daily contributes to protecting against depression. This

Two data scientists are discussing a strategy to select a subset of predictors for a model with n = 5,000 observations and p = 400 predictors. The rst suggests that they perform a forward stepwise selection procedure starting with a null model. Of these resulting models, they would nally choose the one with the smallest RSS. The second objects,

We test a new blood-pressure drug on 25 patients, using 27 other patients as a control group receiving a placebo. The test group had a mean systolic blood-pressure reduction of 11mm Hg, with a standard deviation of 4mm Hg, while the control group had a mean reduction of 5mm Hg with a standard deviation of 3mm Hg. Test the null hypothesis that the

13. Use an algebraic method to find the horizontal intercepts of this area function. Show the equation you solved and how you solved it
image text in transcribed

60) A survey of 800 women shoppers found that 17% of them shop on impulse. What is the 98% confidence interval for the true proportion of women shoppers who shop on impulse? A) 0.136
image text in transcribed

A bookshelf sits on top of a large desk. Together, their height is 6.75 feet. The difference between their heights is 1.85 feet. How tall is the bookshelf? Let the height of the bookshelf = and the height of the desk = . 4.30 feet 5.10 feet 2.45 feet 2.05 feet

\f
image text in transcribed

To multiply a decimal by a power of 10, move the decimal point _____. Multiple choice question. one place to the right for each power of 10 one place to the left for each power of 10 two places to the right for each power of 10 two places to the left for each power of 10

Exp 4: Column Chromatography Started: Sep 19 at 9:50pm Quiz Instructions Note: this is a timed quiz. You may check the remaining time you have at any point while taking the quiz by pressing the keyboard combination SHIFT, ALT, and T... Again: SHIFT, ALT, and T... Question 1 Tips 1 pts How do you turn on your sand bath? Group of answer choices Plug

You want to estimate the percentage of people who drink a certain soft drink with 95% confidence. How large a sample is needed if you want to be accurate to within 2.8%? Use the fact that a prior estimate of p = 29% is available.

Watch the center describe classroom, actions and sequence, then match each action with its corresponding number in order 1.4 worksheet part two

Solve the system below with the elimination method. Submit your answer as an ordered pair (x,y) without spaces. If there is more than one solution, enter (x,mx-b) where m and b are integers. If there is no solution, write: No Solution 0.2x+4.7y=27.6 1.5x+1.1y=2.1

Suppose X and Y are random variables with the following joint density (see attached image) \f
image text in transcribed

Stem. Leaf 1. 00012333457999 2. 0001124455667777779999 3. 033356777889 4. 0114445677778899 5. 01224446788 the value 33 appears ___ times in the data set. The value 27 appears ___ times in the data set. The value 36 appears ___ times in the data set.

how many combinations of one motorcycle can be made out of: 3 frames 3 handlebars 3 wheel sets 4 tires choices

1.Suppose you take a standardized test and you are in the 10th percentile. What does this percentile mean? Can you say that you failed the test? Explain.

explain Operating on Functions and explain the algebra and geometry behind each operation. give an example of when you would apply that operation to functions

I need some example to understand what effect does sample size have on research results for presidential election?

Find the volume of each figure. Round to nearest tenth, if necessary. \f
image text in transcribed

What is the selection's thesis? Locate the sentence(s) in which Suina states his main idea. If he doesn't state the thesis explicitly, express it in your own words
image text in transcribed

How many pounds of fluid would be present in Violet, a healthy woman who is 5'4" tall, weighs 128 pounds, and is moderately active? Question 2 options: a) about 76.8 pounds b) about 64.0 pounds c) about 6.4 pounds d) about 21.3 pounds e) about 96.0 pounds

For a given vector v Rn, the mean can be found as the solution to the optimization problem min vx12, (1) xR where 1 is the vector of ones in Rn. Similarly, the median (any value x such that there is an equal number of values in v above or below x) can be found via

\f\f
image text in transcribedimage text in transcribed

can someone please answer questions 1-5 and show their work Show all work, choose any method you are comfortable with. Find the product and have your final answer in the form of a + bi. 1. (2 - 5i) . (-4 + 3i) 2. (-4 - 2i) . (3 - 51) 3. (3 + 8i) . (5 - 2i) 4. (4 - 51) . (6 - 3i) 5. (-8 + 7i) . (7 - 41)
image text in transcribed

Historical record of Earthquakes in Pasadena from 1836 to 1961 shows that there were 16 earthquakes with ground intensity in MM-scale of VI or higher. If the occurrence of such high-intensity earthquakes can be assumed to constitute a Poisson process, what is the probability that the next high-intensity earthquake will occur within the next 2

In emergency planning, HSM 315, what are the Differences in risk communication versus normal communication?

which of the following is true about the correlation coefficient (r) if the correlation of determination (r squared) is equal to 1? can be either -1 or 1 can by any value between -1 and 1 must be -1 must be 1

In the past, the average age of employees of a large corporation has been 40 years. Recently, the company has been hiring older workers. In order to determine if there has been an increase in the average age of employees a Hypothesis Test will be performed. The test will use a sample of 60 employees and a level of significance of 0.05. The

Write the augmented matrix for the system of equations to the right. X - y + 10z = Co y - 14z = - 10 Z= Enter each element. (Do not simplify.)
image text in transcribed

Smaft phone: Among 339. cell phone owners aged. 18-24 surveyed. 103. said their. phone was an Android phone. \f
image text in transcribed

A company wants to promote its new office location with a billboard that requires a flat monthly fee of 460 dollars along with a rate of $10 per square foot of its area for its initial design cost. How much total will the advertising cost them for the first month if the billboard is 13 feet by 44 feet

how do I find the probability Let x have an exponential distribution with 1 = 1. Find the probability. (Round your answer to four decimal places.) P(x
image text in transcribed

Identify incorrect statement: Group of answer choices A system can be divided into pieces, each of which can function on their own A system is a series of interconnected parts. A heap is merely a collection of parts A heap can be divided into pieces, each of which can function on their own

content area top Part 1 If you make an investment of $3 comma 500 and the investment earns a continuous annual interest rate of 3.2%, in how much many years will it be worth $8000? Question content area bottom Part 1 In enter your response here years. (Round to the nearest tenth.)

Annika was having fun playing poker. She needed the next two cards dealt to be diamonds so she could make a flush (five cards of the same suit). There are 15 cards left in the deck, and five are diamonds. What is the probability that the two cards dealt to Annika (without replacement) will both be diamonds? Answer choices are in percentage format,

QUESTION 2 Say the value of the horizontal asymptote of the function: 8x f(x) = ------------ x2 - 25 x=-8 x=5/8 x=0 None of the above

CREATIVE PEOPL ARE QUICK TO MAKE ASSOCIATION.CAN YOU ASSSOCATE A SPELLINBG WORD WITH THE FOLLOWING CLUES LIKE MERROR

we know that the standard deviation of starting salaries is $17,000. For the academic year ending in May 2017, 40 students responded to the survey and the school reported that the average starting salary was between {$67,000 and $77,000}. What was the confidence level at which the inference was made?

Suppose you compute a confidence interval with a sample size of 100.What will happen to the confidence interval if the sample size decreases to 80? (8.1.4)

Consider the following (true) theorem: If G is a Eulerian planar graph where every face is a triangle, then the vertices of G can be coloured red, white, and blue, so no two adjacent vertices are given the same colour. (a) What is the dual statement of the above theorem. (b) Provide two graphs, one that satisfies the conditions of the first

A researcher claims that the standard deviation of the number of deaths annually from tornadoes in the United States is less than 37. If a random sample of 21 years had a standard deviation of 34, is the claim believable? Use a=0.05

(4 pts) There are pros and cons for using either form, the decimal approximation form or the exact form. Discuss the pros and cons below (at least one pro and one con for each form)
image text in transcribed

\f
image text in transcribed

Fill in the blanks: Lisa Keller = A- Possible genotypes: Kevin Keller = O+ Possible genotypes: Lisa gametes/ 14. Kevin gametes i- 14-i- i-i- i+ Possible phenotypes of kids: Phenotype 1: Phenotype 2
image text in transcribed

Which statement below is incorrect? Select one: A.If I want to generate a series of "1 1 2 2 3 3 4 4 11", I can use the R code of "rep (1,2,3,4, each=2, length=10)". B.It is possible that when we minimize the volatility to achieve a target return, the Sharpe ratios are the same in scenarios with and without short sale constraints. C.I run the

Graph the solution to the following inequality on the number line. x2 - 2x28 Note that you can use the ALEKS graphing calculator to help get your answer 09 8 -7 6 5 4 3 2 10 1 2 3 4 5 6 7 8 9 10 O X
image text in transcribed

exponential and logarithmic functions create a y1 funcon that models the increasing value of the loan. Show it as we would show a calculator window and window sengs, in our class. Use an xmin value of 0 to indicate the year 2024 and a xmax value of 5 to indicate 2029. Use an appropriate ymin and ymax. Explain the significance of "a" and "b" in

Combine and simplify: 2 -3 + 5 x -1 7 - 11 ( -3) ( -1) 7 - 17 ( - 3) ( - 1) 7 2X -4 7 ( -3) ( -1)

4. 55 If the angles of ARST are mLR = (9x - 2) , maS = (4x + 36) , and m/T = (5x + 20) , list the sides in order from shortest to longest. 9 x - 2 + 4 x+ 36+ 5x + 20 9(7 ) - 2 4( 7) + 36 180 = 18x+ 54 - sy 126= 18x 7 = X
image text in transcribed

I am having trouble with the Agresti andCoull's method. Need help with the problem below and understanding this method. Thank you! Jane wants to estimate the proportion of students on her campus who eat cauliflower. After surveying 37 students, she finds 5 who eat cauliflower. Obtain and interpret a 99 % confidence interval for the proportion of

If X ~ Exponential (2), does this mean beta =2 or lambda=2? So what is the expected value for X ~ Exponential (2)? \f
image text in transcribed

The number of students using the ATM on campus daily is normally distributed with a mean of 237.6 and a standard deviation of 26.3. For a random sample of 55 days, what is the probability that the ATM usage averaged more than 230 students per day? A. 0.9756 B. 0.9838 C. 0.9524 D. 0.9483

Suppose you go on a trip to Las Vegas. You stop at a slot machine where there is a 0.008 probability of winning the jackpot on a single turn. You decide to play the slot machine 2,000 times. For each problem, circle the appropriate numbers on the number line, then calculate the probability and round all answers to 4 decimals. Make sure you write

The time x in years that an employee spent at a company and the employee's hourly pay, y, for 5 employees are listed in the table below. Calculate the correlation coefficient r. x y 5 25 3 20 4 21 10 35 15 38

Which of following is not true of the sample standard deviation? The sample standard deviation is often used to construct confidence intervals. The sample standard deviation is the square root of the variance. The sample standard deviation is often used in hypothesis testing. The sample standard deviation can be negative. The sample standard

Find thez-score that has 70.9% of thedistribution's area to its right.

There are 1,137 cases per 100,000 population in AZ this year. Is this number a count, rate, ratio, or proportion? What does this number actually tell us in lay terms? What implications does the data have for the people in the area?

What is the first step in the hypothesis testing process? Gather Data from the sample Determine the level of statistical significance Find the test statistic Determine your hypotheses

1.If the mean of five values 64, find the sum of the values

Multiply. left parenthesis 2 x minus 5 right parenthesis squared

Determine the equation of the tangent to the curve defined byf(x)=x2+4x+1 at point (-5, 6) using the first principal definition of calculus

A population of 40 deer are introduced into a wildlife sanctuary.It is estimated that the sanctuary can sustain up to 500 deer.Absent constraints, the population would grow by 20% per year.What is the population after two years.

What is the probability of three calls in five minutes

6. A truncated discrete distribution is one in which a particular class cannot be observed and is eliminated from the sample space. In particular, if X has range 0, 1, 2, ... and the class can not be observed (as is usually the 2case), the 0-truncated random variable X_T has pmf P(X_T = x) = P(X = x)/ P(X > 0), x = 1, 2, ... Find the pmf, the mean

Consider the following data for a dependent variableand two independent variables,and; for these data, and. 301395461110824181135117178416945119176757171371211859141437716211Round your answers to three decimal places. a. Compute. b. Compute. c. Does the estimated regression equation explain a large amount of the variability in the data? - Select

The mean 1 sd of calcium intake (mg) among 25 females, 12 to 14 years of age, below the poverty level is 6.56 0.64. Similarly, the mean 1 sd of calcium intake (mg) among a separate group of 40 females, 12 to 14 years of age, above the poverty level is 6.80 0.76. Compute a 95% confidence interval for the difference in means between the two groups.

An investor is considering a $10,000 investment in a start-up company. She estimates that she has probability 0.1 of a $5000 loss, probability 0.1 of a $15,000 profit, probability 0.25 of a $20,000 profit, and probability 0.55 of breaking even (a profit of $0). What is the expected value of the profit?

Graph the trigonometric function. Please write it neatly on your paper so that I can comprehend the process. Graph the trigonometric function. y = 3 cos
image text in transcribed

Find an equation of the tangent to the curve at the point corresponding to the given value of the parameter. x=+\\t, y=t*-2t; t=16
image text in transcribed

Para emitir un correo electrnico, tanto el emisor como el perceptor... Grupo de opciones de respuesta Deben estar en lugares diferentes Tener conexin a internet Deben tener disposicin para entablar dicho intercambio No deben tener recursos naturales, humanos, financieros y tiempo Deben tener recursos materiales, humanos, financieros y tiempo

(07.01 LC) For circle C, CG = CE, CG is perpendicular to FB, and CE is perpendicular to DA. What conclusion can be made? D E A C G B O FB = DA O DC || CA O GC |ICE O FG = GC
image text in transcribed

A given distribution has a population mean, , of 100 and a population standard deviation, , of 8.What z-score would be associated with the value x = 131? Round to two decimal places, as needed.

An experiment consists of tossing two, 12-sided dice (the numbers 1-12 are printed on the sides of each die). Let Event A = both dice show an even number. Let Event B = both dice show a number more than eight. Events A and B are: Question 5 options: A) mutually exclusive B) independent C) mutually exclusive and independent D) neither mutually

A subassembly process includes 4 machining steps. The yields for each step are 0.89, 0.89,0.91 and 0.73, respectively.Assuming the steps are independent, calculate the throughput yield of the sub-assembly process.

construct a 95% confidence interval of the population proportion using the given information x=105, n=150 what is the upper And lower bound \f
image text in transcribed

Fill in each blank with the correct time. (11:20 p.m.) Il est 1 of 1 du soir. (12:00 p.m.) Il est 1 of 1 . (2:05 p.m.) Il est 1 of 1 de l'aprs-midi. (9:00 a.m.) Il est 1 of 1 du matin. (7:45 a.m.) Il est 1 of 1 du matin. (12:15 p.m.) Il est 1 of 1 . (10:45 a.m) Il est 1 of 1 du matin. (3:15 p.m.) Il est 1 of 1 de l'aprs-midi. (5:15 a.m.) Il est 1

A point is chosen randomly on PS . Identify the probability that the point is on RS . The figure shows segment P S with two points Q and R on it in order from left to right. The length of segment P Q is 2 units. The length of segment Q R is 6 units. The length of segment R S is 5 units. 2/13 8/13 11/13 5/13

Please help me solve the following problem... A coin mint has a specification that a particular coin has a mean weight of 2.5 g. A sample of 33 coins was collected. Those coins have a mean weight of 2.49385 g and a standard deviation of 0.01282 g. Use a 0.05 significance level to test the claim that this sample is from a population with a mean

3. a) a1 = 1, an = 2an_1 + n if n > 1. Come up with a recursive algorithm to compute an b) (21 = 1, a2 = 2, an = 2an_1 + an_2 + n if n > 2. Come up with a recursive algorithm to compute an
image text in transcribed

GEOL 1403 [Answer only questions in Adobe pdf document - email abichler@lee.edu for questions] Unit 9 Lab - (Lab 6 in manual pages 119 - 136) Topographic Maps x110 x 100 X1 10 XIOD k110 BCx *90 100 100 x80 XBD ADO Figure 6.9 Map of a Stream Valley. Cl =
image text in transcribed

In the parable of the laborers, each man received a penny for his wage. Some worked for one hour and some for longer periods of time - up to twelve hours. The penny represented... In the parable of the laborers, each man received a penny for his wage. Some worked for one hour and some for longer periods of time - up to twelve hours. The penny

quantitative data where scale zero means quantity = 0, and the ration of two values is meaningful are called? quantitative data where the differences between measurements is relative, and scale zero is a place holder that does not mean quantity = 0 are called? qualitative data consisting of labels without a sense of order or rank are called?

V If a person's eye level is h meters above sea level and she can see d kilometers to the horizon, then d=3.57 h. Suppose the person's eye level is 4.41 meters above sea level. How far can she see to the horizon? Round your answer to the nearest tenth. kilometers X
image text in transcribed

This is complex variable. I am returning student, so in detailed explanation please. Thank you. \f
image text in transcribed

Wired glass can be broken, but it shatters into small, pebble-like pieces rather than sharp silvers. Group of answer choices True False

Showing 800 - 900 of 1522
  • 9 / 16