S
  1. study help
  2. subject categories
  3. sciences
  4. mathematics
  5. august 2022
  6. 26

Mathematics Questions and Answers August 26, 2022

Expert-verified solutions to help you succeed

Let f(x)equals4 x minus 7. The average rate of change from 1 to 4 is

The additional growth of plants in one week are recorded for 11 plants with a sample standard deviation of 1 inches and sample mean of 9 inches. t* at the 0.05 significance level = __________Margin of error= _____________Confidence interval= [_______ , _______] The additional growth of plants in one week are recorded for 11 plants with a sample
image text in transcribed

A large company takes a sample of 32 of its employees. Their ages are: {21, 21, 22, 24, 24, 26, 26, 26, 29, 31, 32, 34, 35, 37, 37, 38, 41, 45, 47, 48, 49, 52, 52, 52, 52, 59, 60, 62, 63, 65, 65, 65} What is the 99% confidence interval for the population mean employee age for this company? (35.773, 47.977) (35.222, 45.528) (35.117, 48.663)

A researcher tests the hypothesis that the mean body temperature of residents in a nursing home is 98.6 degrees. Which statistical test could the researcher use? Group of answer choices Chi-squared test One sample t test Mann-Whitney U test Independent group t test

Derive the CFL limit for the standard 4 step Runge-Kutta scheme applied to the 1D linear advection equation. Plot your results for a variety of Courant numbers. You will find that the /2 mode is the first to go unstable as you increase , so the limiting Courant number (CFL limit) is that which arises at =/2. So by trial and error determine to

The agesof 10 college students who are enrolled in statistics. 6, 69, 75, 80, 87, 94, 110, 115, 124, 195 10. Median of the data is 11. 25th percentile of the data is 12. 75th percentile of the data is 13. IQR of the data is 14. Identify all the outliers (if any).?

Question 4 Consider Binomial(30, 0.3) distribution. Do the following tasks: 4.1 Find the mean and standard deviation. 4.2 Find the probability of 4. 4.3 What is the probability that the value of the random variable is 2? Question 5 Use the following observation to find; = 60, = 40, 2 = 4160, 2 = 1720, = 1150, = 10 5.1 Slope 5.2 Intercept 5.3

Using the calculated margin of error and the pairwise confidence interval approach, test the following statements: i. Under normal summer road conditions, does light vs. heavy cannabis intake makes a significant difference on driving abilities if you wait 4 hours before driving? ii. After a heavy intake of cannabis, does ice rain vs normal summer
image text in transcribed

\f
image text in transcribed

e Assume you have opened up your own bakery. The COST TO MAKE a loaf of fresh bread is $2.50. There is a mark-up of 80%. After 3 months you do an additional mark-up of 30% thus based on the two mark-ups, that will reflect the SELLING PRICE. What is the selling price? a. $2.00 b. $1.35 c. $3.35 d. NONE of the ANSWERS are CORRECT e. $1.50

The system is telling me that my answers are completely wrong on both the mean and standard deviation. I used a calculator to find both answers. Can you please explain what I did wrong. The number of tickets purchased by an individual for Beckham College's holiday music festival is a uniformly distributed random variable ranging from 5 to 15. Find
image text in transcribed

Sonny purchased 10 acres of land in 1970 for $20,000. In 2000, he sold the land for $100,000. What were the total and annual returns on his investment. The total return on his investment was: [a] %. (Enter a percent rounded to two decimal places.) The answer wasn't 5.51% because it was marked wrong.

Please answer the question Consider the number of hits at Google.pk to be a Poisson random variable, N. The probability distribution is then as follows: PIN = n = n! where a = At, while A represents the average number of hits in a time interval. Consider 1 = E hits per second. Find the probability that there is no more than I hit in an interval of
image text in transcribed

You are the manager of a project to improve a billing process at your firm. Table 7.7 contains the data you will need to conduct a cost analysis of the project. Indirect costs are $1,600 per week, and penalty costs are $1,200 per week after week 12. a. What is the minimum-cost schedule for this project? b. What is the difference in total project
image text in transcribed

A big organisation for competitive pro-gamers experiences lag during a large portion of their online games. Lag is a noticeable delay (latency) between the action of players (input) and the reaction of the server supporting the game. Every online gamer experiences lag on occasion, however if this occurs more frequently to you compared to your

What is the interval in which both f (x) and g(x) are negative? Rational function f of x with one piece decreasing from the left asymptotic to the line y equals negative 2 and passing through the point 0 comma negative 3 and through 1 comma negative 4 to the right asymptotic to the line x equals 2 and another piece decreasing from the left

Answer within 1 hour please. To be submitted: Consider a game played with a standard poker deck of cards in which you can score 0, 6 or 9 points on any one hand. Suppose that the probability for each of the 3 possible points is 1/3. Let X be the number of points scored a hand. A random sample of n = 3 hands is taken. (you can assume sampling with
image text in transcribed

#7: Use the Q7 dataframe. You want a 'good' model predicting Wins from all variables (without interactions). Perform the 'all possible' approach, which produces a list of models with whose Ale are within 4 of the overall lowest AIC of all considered models. Identify the predictors in the model with the FEWEST predictors (it could be the case your
image text in transcribed

In a study of government financial aid for collegestudents, it becomes necessary to estimate the percentage offull-time college students who earn abachelor's degree in four years or less. Find the sample size needed to estimate that percentage. Use a 0.05 margin of error and use a confidence level of 99%. Complete parts(a) through(c) below. a.

d) Perform the appropriate statistical test using the attached screenshot. e) Report your decision based on the critical value (reject Ho and accept H A OR fail to reject Ho), P-value, and 95% confidence interval. f) If the decision was to fail to reject Ho, can Ho be accepted? Regular 12 a BIU 1 y Times 11 B / U E = 1 1v Helvetica Bold Ta 15 16
image text in transcribed

Here is an interesting Probability question: There are 30 books sent 5 persons, and each person can get 6 books. 10 of the 24 books are secondhand. All possible outcomes are equally likely. So: A = person #1 receives 3 secondhand books. B = person #2 receives 6 secondhand books. C = person #3 receives 5 secondhand books. D = person #4 receives 1

Suppose you manage an algorithmic trading operation where computers are trading in the stock market automatically without human intervention using algorithms.Suppose that your algorithm called "Shining Star" (SS) makes an average profit of $6000 each trading hour in the stock market.However, your gut instinct is that the algorithm's performance

Directions solving problem using TI-84 21. National Exit Polls published by ABC News (http://www.ABCNews.com) for the 2000 presidential election showed that 49% of people that voted for Vice President Gore worked full time for pay and 48% of people that voted for Governor Bush worked full time for pay. a) Given the sample size for each of these
image text in transcribed

TP16Q4. An insurance company has discovered a potential positive relationship between the number of fire fighters tending a fire, and the amount of property damage (in dollars) resulting from the blaze. The company keeps records on all fires and associated property damage for fires that require the aid of at least three (3) fire fighters. The
image text in transcribed

Projection 2 objectives: Write the matrix that represents projection onto a space spanned by more than one vector Find the projection of a vector onto a space spanned by more than one vector Use projection to write a vector as the sum of one vector Inside a space and another vector orthogone to It Problem 1: Find the matrix that projects a vector
image text in transcribedimage text in transcribed

A random sample of 11 insurance claims for water damage is selected, yielding a sample mean claim amount of $6400 and sample standard deviation of $800. Assume that claim amounts (in $) for water damage are normally distributed. Question 4[7 marks]: A random sample of 11 insurance claims for water damage is selected, yielding a sample mean claim
image text in transcribed

5.3 The Project: How long is this going to take?/Progress Check (GRP) gantt

A university student is selecting courses for his next semester. He can choose from7 humanities courses and6 science courses. In how many ways can he choose5 courses if 1 or fewer must be humanities courses? Counting and Probability TOPIC NAME Counting using combinations and addition

A dartboard has 10 equally sized slices numbered from 1 to 10. Some are grey and some are white. The slices numbered 1,2 ,3 ,5 ,6 ,8 , and 9 are grey. The slices numbered 4,7, and 10 are white. A dart is tossed and lands on a slice at random. Let X be the event that the dart lands on a grey slice, and let P (X) be the probability of X . Let not X

1. A license plate has 4 letters followed by 3 single digit numbers (i.e. 0, 1, 2, ...9). How many possible license plates are there? 2. (a) How many 2 letter passwords can be formed using the letters {A, B, C, D} (w/ repetition allowed)? (b) How many 2 letter passwords can be formed using the letters {A, B, C, D} w/o repetition? Record all the

If x= 3/5 , then x4= Select one: a. 81/625 b. 12/20 c. 20/12 d. 625/81 e. 625/81

Idk why my answer is wrong Hw24-15.9-Triple-Integrals-in-Spherical-Co Problem Value: 1 point(s). Problem Score 0%. Attempts Remaining: 18 attempts Help Entering Answers (1 point) Write the equation z = /3z2 +3y2 in spherical coordinates cot(th)=1.732 W (Simplify as much as possible) Write the equation 322 + 2=2 - 9 in spherical coordinates.
image text in transcribed

In how many different ways can first-place, second-place, and third-place be decided in a 21 -person race? Express the answer to the permutation problem using permutation notation (Pkn) and numerically

Identify thecase study with the following hypothesis. Justify your answer A hypothesis is made telling that improving school lunches in elementary schools will decrease obesity among the students. You have randomly identified 6 elementary school in Ahmedabad to participate in the study. Also tell what will be your intervention

result in fraction of (1/2+2/3) divided by 2/5 equals ?One half of the sum of two numbers is 90. If one of the numbers is 50, what is the product of the two numbers?One half of the sum of two numbers is 90. If one of the numbers is 50, what is the product of the two numbers

Summary: Professional Assignment 1 - CLO1, CLO2 Using LIRN (or JSTOR), Internet, and the textbook, please develop and prepare an APA formatted paper that provides an analysis of all of the following topics. Please include a management decision-making perspective in each topic you analyze: Define Statistics and the different types of statistics, as

Hii please help me with my calculus and vectors grade 12 homework. Please make sure all answers are detailed and have all steps and are hand written. Thank you so much _1. If u = [2, 3, 4] and v = [-7, -6, -5] find |u - vl a) [9, 9, 9] b) V434 c) 9V3 d) none of these 2. If u = [0, 3, 4] and v = [0, 2, 0] find u x v a) [-8, 0, 0] b) 8 C) 4V2 d)
image text in transcribedimage text in transcribedimage text in transcribed

The distance d, in miles, that a car travels on a 6-hour trip is proportional to its speed s (which we assume remains the same throughout the trip), in miles per hour. What is the constant of proportionality in this case? Exercise (a) The distance d, in miles, that a car travels on a 6-hour trip is proportional to its speed s (which we assume

Hello, I am having trouble with this problem and would like help; use the normal distribution and the given sample results to complete the test of the given hypotheses. Assume the results come from a random sample and use a 5% significance level. Test H 0 : p =0.5vs Ha : p >0.5using the sample resultsp= 0.60with n =25 Test statistic= p-value=

Susan Sound predicts that students will learn most effectively with a constant background sound, as opposed to an unpredictable sound or no sound at all. She randomly divides sixteen students into two groups of eight. All students study a passage of text for 30 minutes. Those in group 1 study with background sound at a constant volume in the

Hello! I'm having a little trouble coming up with the solution for these homework questions: Part 1: Solve the following equations for variable x: Question 1: -4(2x -3) = 8(1 + x) + 5 Question 2: (x - 5)(x + 7) = (x + 2)(x - 9) Question 3: [4=(x - 2)] [3=(x + 3)] = 7=(x^2 + x - 6) Question 4: x + j= (x2 + 4x + 2)=(x - j), where jis a parameter.

A sample of 106 body temperatures is having a mean of 98.20F and a standard deviation of 0.62F. Construct a 95% confidence interval estimate of the mean body temperature for the entire population. a. Determine the critical value b. Find the margin of error c. Find the confidence interval for the true population mean d. What does the result suggest

Past period Demand June 125 July 250 Aug. 285 Sept. 410 Oct. 485 1)Compute a weighted moving average forecast for November. Use the following weights: 0.5 for Oct., 0.3 for Sept., and 0.2 for August. A.422.5 B.312.8 C.529.0 D.485.0 2)Compute an exponential smoothing forecast for November. Assume forecast for September is 425.5, and use a smoothing

Find the absolute maximum and absolute minimum values of f on the given interval. f ( t ) =5 t +5cot( t /2),[ /4, 7 /4]

3. Solve the equation 2sin 6+ sin @ 17sin\" 0 dsind + 6 = (. Notice how this equation looks very similar to #4 on exam 2. Use a substitution w = sin @ and solve for w via the solution to that exam problem to find all solutions for 6
image text in transcribed

Assume an exchange rate of US$1 = CA$0.994. How can you determine the number of Canadian dollars that can be obtained for $650 U.S. dollars? Multiple choice question. US$650 (CA$0.994/US$1) US$650/CA$0.994 US$650/(CA$0.994/US$1) US$650 (US$1/CA$0.994)

What price do farmers get for their watermelon crops? In the third week of July, a random sample of44farming regions gave a sample mean of= $6.88per 100 pounds of watermelon. Assume that is known to be$2.00per 100 pounds. (a)Find a 90% confidence interval for the population mean price (per 100 pounds) that farmers in this region get for their

Given the following Regression from an applied research which has three main variables DLRGDP -DRT-Trend interpret these results in an economic vision ( the tested variables significance , the model significance , the model Strength , the difference between R2 and ANOVA test , the relation between T-test and Probability ) \f
image text in transcribed

Can you please help me solve this question Use the four-step process to find f (x) and then find f'(1), f'(3), and f'(6). f(x) = 2x - x - 3 f' ( x ) = f' (1) = (Type an integer or a simplified fraction.) f'(3) = (Type an integer or a simplified fraction.) f' (6) = (Type an integer or a simplified fraction.)
image text in transcribed

Translate New Tab Dashboard Question 16 2 pts Answer the following questions concerning the descriptive statistics listed below. These descriptive statistics were generated from a random sample of all USF students and contain information about the amount of time they exercise per week and the amount of student loan debt (in thousands of dollars)
image text in transcribedimage text in transcribedimage text in transcribed

Find the critical values x and x- for the given confidence level c and sample size n. C = 0.98, n = 18 X3 = 7.564 (Round to three decimal places as needed.)
image text in transcribed

P(t) = 7et/8 Your computer continues with a note from the files that the alien civilization performed these calculations on the linearization of P(t)_ Therefore, you will need to linearize P{t) and then use that model to determine when to remove the light source to have 7.196 million bacteria. Your linearization should be around t = 0, since this
image text in transcribed

Grade 5 Party Planning PT. ASH Party Planning Performance Task Paulette is planning a birthday party. She will serve hamburgers, hot dogs, cheese cake and lemonade. Including Paulette, 30 people will be at the party. Use this information to help Paulette plan her party. Show your work or explain your thinking. Round all dollar values to the
image text in transcribedimage text in transcribedimage text in transcribed

Given r(t) = 2e^t , e^t cos t, e^t sin t , determine the unit tangent vector T(t) evaluated at t = 0 (find N(t), B(t) also if possible

Each trial in a binomial distribution is independent of the others. (T/F) In a probability distribution all possible trials are between -1 and 1, inclusive. (T/F) Conditional probability is used when the two events are independent. (T/F) For any sample space, the sum of all probabilities is equal to one. (T/F) The essential difference between a

A professor of a law school observes that only 25% of the students who get admitted to the freshmen class reach fourth year. Assuming that this is correct, find the probability that among 15 randomly selectedfirst year students that at most 5 students will reach fourth year.

14. You are interested in examining whether changes in the minimum wage influence youth employment. You gather data on youth employment for Ontario and Quebec in the years 2015 and 2018. The following table displays the share of youths who are working: Ontario Quebec 2015 0.45 0.37 2018 0.42 0.38 a) Use this data to construct the
image text in transcribed

calculus math 30 State the domain and range in both interval and set notation. 3. 4 . - : D : 9 x 1 X EIRY ( - 20, 20 ) R: q ylyEIRY ( - 00 , 00 ) 5 . 6. D : Y x 1 - 3
image text in transcribed

Mean, = 7.5 Standard Deviation, = 4.33 A random number generator is set to produce any real number between 0 and 15 and it is uniformly distributed.What is the probability that a sample average of 13 numbers produce an average less than 4? Round to the ten-thousands place.

tive and Qualitative Sampling and Collection i A firm draws 25 weekly punch cards to determine an estimate of the percent of 200 employees who clock in late returning from lunch. This estimate is a Multiple Choice O population parameter O sampling method O simple random sample O sample statistic O target population

12 Given QM output on a product-mix problem as below: Objective: Maximize Results ---------- X1 X2 RHS Dual --------------------------------------------------------------------------------- Maximize 40 50 Material A 1 2

just looking for assistance, thanks Problem Set 1A Use the following information to answer the next seven exercises: Studies are often done by pharmaceutical companies to determine the effectiveness of a treatment program. Suppose that a new AIDS antibody drug is currently under study. It is given to patients once the AIDS symptoms have revealed
image text in transcribed

suppose f is a function with exponential growth. show that there is a number b>1 such that f(x+1)=bf(x) for every x.

Statistics assignment 6 Question 2 A Research found that 70% of Jamaicans do not think that having a college education is important to succeed in the business world. Assume that this holds true for the entire population. If a random sample of 20 Jamaicans are selected, using the binomial formula, find these probabilities (to the 1s three none zero
image text in transcribed

How to complete problem? All info already provided. roblem 1 - 12 POINTS TOTAL. Inder sets, State Space, and Determining pmfs. et Z be an exponential random variable with pdf fz(z) = de * where A > 0. A rando rocess X is defined as: X, = {X,,t 2 0 where X, = u(-(t - Z)) } Note that u(-(t - Z)) is the unit step function which is 1 for values of t
image text in transcribed

$2,674 is invested at 6% APR for 10 years, compounded monthly. What will be the balance on the account? Round your answer to the nearest cent

For this problem, carry at least four digits after the decimal in your calculations. Answers may vary slightly due to rounding. In a marketing survey, a random sample of980supermarket shoppers revealed that266always stock up on an item when they find that item at a real bargain price. (a)Let p represent the proportion of all supermarket shoppers

I am a parallelogram. Two of my sides are parallel to the bottom of the paper. The endpoints of the bottom side are at (2, 6) and (9, 6). The slope of the line segments that form my two sides is 0.75, and the length of each side is 5 units. What are my other two vertices? smaller x-value (x, y) = Incorrect: Your answer is incorrect. larger x-value

Round 20 to the tens place and 5498 to the thousands place The estimated value of 549820 is

A recent study examined hearing loss data for 1666 U.S. teenagers. In this sample, 307 were found to have some level of hearing loss. News of this study spread quickly, with many news articles blaming the prevalence of hearing loss on the higher use of ear buds by teens. At MSNBC.com (8/17/2010), Carla Johnson summarized the study with the

What value of z* should be used to construct a 95% confidence interval of a population mean? Answer choices are rounded to the hundredths place.

Check out this snippet from Family Circle magazine (January, 2009, Liz Plosser): Motorists who talk on a cell phone while driving are 9% slower to hit the brakes, 19% slower to resume normal speed after braking and four times more likely to crash. Interesting, eh? Need more information? Sorry, that's all the information this article provided. So,

Find the slope of the tangent line to the given polar curve at the point specified by the value of . r = cos( /3), =

For this practical application assignment, you will download five years of daily adjusted closing price and volume data from Yahoo Finance (or another site of your choosing) and perform a descriptive analysis. You will be using this data for four modules in this course. Go to Yahoo! Finance, linked in Resources.For Sprint Find a stock beginning

On hot , sunny , summer days , Jane rents inner tubes by the river that runs through her town . Based on her past experience , she has assigned the following probability distribution to the number of tubes she will rent on a randomly selected day . 25 50 75 100 Total FIXI . 16 . 36 . 38 . 10 1 . 00 ( a ) Find the probability expressions : ( Round
image text in transcribed

Need help figuring out how to answer this problem. (2) Supersonic flow (M=3.0) passes a friangle shape object, Try to compute CL. (8pt) Whei le the pitot lube reading? (2pt) 10 lin (MI ) V. = 9470 M=3.0 P=1atm 49, 76 +5 = 69:76 = VL M 3= VP 300 / pitot tube V2 - 49, 76 HIS 3.9 = ML 36 . 73 150 V2= 64, 76 -7 MEL PI 6= 79, 76 1:32, 3 (( mz) MI = 3
image text in transcribed

A research group conducted an extensive survey of2889wage and salaried workers on issues ranging from relationships with their bosses to household chores. The data were gathered through hour-long telephone interviews with a nationally representative sample. In response to the question, "What does success mean to you?"1476responded, "Personal

3. Compute y(t). Hint: You will need to get the denominator in the form of (s+a)2+b for this

From the list of all following 100 Weight data listed below, select a sample of 30 weights, using one of the sampling methods we have studied. 120, 145, 118, 162, 106, 143, 160, 215, 127, 132, 196, 109, 170, 187, 234, 199, 143, 156, 142, 123, 165, 157, 121, 131, 128, 143, 152, 119, 111, 149, 179, 206, 191, 156, 122, 175, 194, 132, 188, 125, 1069,

Can someone help me with these problems The inverse of the matrix -37/352 -5/32 13/352 B = 15/176 -1/16 9/176 3/352 3/32 37/352 is -4 J B-1 = -3 3 A V WN Given the related system of equations, 37 352 X 5 + 13 357 2 = -11 15 176 X 1 T6y + 9 2 3 352 X + 3 37.V + 37 357 2 6, find the value of y. Submit Answer Tries 0/10The inverse of the matrix B = 4
image text in transcribedimage text in transcribedimage text in transcribed

The purpose of this assignment is to apply test of independence to a case. AS Instructions: 1. Open the dataset of NYREFORM (attached) and read the case entitled "A Bipartisan Agenda for Change" in its entirety at the end of Chapter 12. 2. Use descriptive statistics to summarize the data and make your preliminary conclusions about the independence

The mean preparation fee H&R Block charged retail customers in 2012 was $183( The Wall Street Journal , March 7, 2012). Use this price as the population mean and assume the population standard deviation of preparation fees is $50. Use z -table. Round your answers to four decimal places. a. What is the probability that the mean price for a sample

400=400 Yes 9. Find the length of segment NM. 16 N 10. Find the length of segment HG. 12 F E G 15 x+8 H Summary I will know I've got it when I can
image text in transcribed

A and B are independent events. Use the following probabilities to answer the question. Round to 4 decimal places. P(A) = 0.29,P(A and B) = 0.17, find P(B) P(B) =

Please help me Table #1: Number of Cell Phones per 100 Residents in Europe 100 76 100 130 75 84 112 84 138 133 118 134 126 188 129 93 64 128 124 122 109 121 127 152 96 63 99 95 151 147 123 95 67 67 118 125 110 115 140 115 141 77 98 102 102 112 118 118 54 23 121 126 47 Table #2: Number of Cell Phones per 100 Residents in the Americas MacBook Air 20
image text in transcribedimage text in transcribedimage text in transcribed

Appropriately conducting and interpreting biostatistical applications require attention to a number of important issues. These include, but are not limited to, the following except: A) Clearly defining the objective or research question B) Selecting a representative sample, and ensuring that the sample is of sufficient size C) Quantifying

can i get help with the entire data project I'm so confused Data Project - Part II Fall 2019 For Students using ALEKS Stat113_[Fill in your section number] Instructor: [Fill in Instructor's Last Name] Name: [Answer goes here] EMPLID: [Answer goes here] Date: [Answer goes here] For this semester you will have a chance to explore a particular
image text in transcribed

An amusement park studied methods for decreasing the waiting time (minutes) for rides by loading and unloading riders more efficiently. Two alternative loading/unloading methods have been proposed. To account for potential differences due to the type of ride and the possible interaction between the method of loading and unloading and the type of
image text in transcribed

I Conclude: Neonatal Assessment Directions: Read the short description of each scenario and determine the newborn assessment finding based on the information provided. Make sure to provide justification for your decision. Leonard was born at 42 weeks and 3 days 1 hour ago, and you are performing a thorough head-to-toe assessment. As you assess his

Consider an undirected graph G = (VG, EG). A label cover problem with unique constraints associates each vertex of the graph with one of k labels {1, . . . , k} and each edge (i, j), with i < j, of the graph with a k-element permutation i,j , i.e., i,j : {1, . . . , k} {1, . . . , k} is one to one and onto. A labeling is valid if the label for

Tori wants to add more interest to the series of photographs that she is preparing to take. In order to do this, where in the photo could she put something eye-catching that will help to pique curiosity? in the far-left distance in the foreground in the background off to the righ

3. A new cold medication was tested by giving 125 people the drug and 100 people a placebo. A control group consisted of 115 people who were given no treatment. The number of people in each group who showed improvement is shown in the table below. Cold drug Placebo Control total Improvement 72 55 38 165 No improvement 53 45 77 175 Total 125 100

2A and 2B please. Thanks 2. The table below shows the political party registration by gender of all 700 registered voters in Franklin Township. Party W Party X Party Y Total Female 98 179 123 400 Male 105 83 112 300 Total 203 262 235 700 a. Given that a randomly selected registered voter registered for Party W, what is the probability that they
image text in transcribed

content area top left Part 1 Graham insists that he cannot write the equation of the line in the graph, which is shown on the right, without knowing what the y-intercept is. Question content area bottom left Part 1 Laura reminds him that all you need to write the equation of a line is and the slope. intercept. vertical line

I need help with this Problem 5 (10 points) Two independent experiments are run in which two different types of paint are compared. Eighteen specimens are painted using type A and the drying time in hours is recorded on each. The same is done with type B. The population standard deviation are both known to be 1.0, assume that the mean drying time
image text in transcribed

If the linear correlation coefficient is -0.368, what is the value of the coefficient of determination? -0.135 0.184 0.736 0.135 If the coefficient of determination is 0.497, what percentage of the data about the regression line is explained? 50.0% 50.3% 49.7% 24.7% If the coefficient of determination is 0.738, what percentage of the data about

f(x) = 25 - X2 dx 30 25 20 15 10 5 -6 -4 -2 2 4 Submit Answer 2. [-/10 Points] DETAILS MY NOTES LARCALC11 4.3.019. Write a definite integral that yields the area of the region. (Do not evaluate the integral.) f(x) = cos(x) dx /www.webassign.net/web/Student/Assignment-Responses/last?dep=33507908#Q8AN - N/N Submit Answer 3. [-/10 Points] DETAILS MY
image text in transcribedimage text in transcribedimage text in transcribed

Hello, please explain your solution if possible. thank you! Consider a random sample of 1200 from a binomial probability distribution with probability of success of 0.20. With probability 0.1, the number of successes is less than how many
image text in transcribed

find the following and round answers to the near thousandth for f(x)=3 x and g(x)=(1/4) x f(2)

computational biology methods A: 0.4 A: 0.1 C: 0.1 C: 0.4 G: 0.1 G: 0.4 Question 2. (15 points) T: 0.4 T: 0.1 1-r 1-r a) (5 points) Consider the HMM shown here, with r = 0.1 2 Suppose that we have a sequence of observations: X = AATAATACGGGCGAGCGAATAAT The path that is most likely to have generated Xis: P = 11111112222222222111111 Find the
image text in transcribed

Showing 400 - 500 of 1499
  • 5 / 15