S
  1. study help
  2. subject categories
  3. sciences
  4. mathematics
  5. february 2023
  6. 24

Mathematics Questions and Answers February 24, 2023

Expert-verified solutions to help you succeed

Three different methods for assembling a product were proposed by the industrial engineer. To investigate the number of units assembled correctly with each method, 30 employees were randomly assigned selected and randomly assigned to three proposed methods in such a way that each method was used by 10 workers. The number of units assembled

Data Gathering And AnalysisToggle Drawer Overview In response to a given scenario, develop a research question hierarchy, determine how you would gather and assess qualitative data, and analyze ethical issues that may present themselves. Compile your work into a 1-2 page analysis with a recommendation based on your results. Note: The assessments

The Internal Revenue Service is studying the category of charitable contributions. A sample of 20 returns is selected from young couples between the ages of 20 and 35 who had an adjusted gross income of more than $100,000. Of these 20 returns, 6 had charitable contributions of more than $1,000. Suppose 4 of these returns are selected for a

It has been found from past experience that of the articles produced by a factory, 20% come from machine 1, 30% come from machine 2 and 50% come from machine 3. The percentages of satisfactory articles among those produced are 95% for machine 1, 85% for machine 2 and 90% for machine 3. (a) An article is chosen at random from a lot. What is the

Complete the following statement: House effects are differences between two survey estimates ... a. ... based on different survey organizations that use different methods. b. ... based on different survey organizations even if identical methods are used. c. ... based on differences in question wording even if identical sampling techniques are

Warren County Telephone Company claims in its annual report that \"the typical customer spends $61 per month on local and long-distance service.\" A sample of 12 subscribers revealed the following amounts spent last month. $65 $64 $63 $68 $57 $64 $67 $65 $65 $59 $54 $66 a. What is the point estimate of the population mean? (Round your answer to 3

1) The number of terms in the expansion of (2x - 3y)9 is ? 2)From a group of 4 adults and 3 children, 3 people are to be selected tosing together. If at most 2 adults can be selected, the number of ways thegroup can be chosen can be calculated using ? 3)A hand of 5 cards is dealt from a standard deck of 52 cards. The numberof ways that the hand

PLEASE SEND BACK TO ME IN EXCEL !!!! Graph each set of data using the XY chart feature in Excel. Add the chart name, Axes descriptions, r squared, and the linear equation to your chart. Interpret the chart. Highest Grossing movies and the year they were released. $2,186.80 1997 $2,068.20 2015 $1,670.40 2015 $1,519.60 2012 $1,516.00 2015 $1,405.40

Use the elimination method to solve the system of equations. 4x - 5y=73 3x + 7y = -42

A random sample of 691 adults showed that 329 of them have shopped at least once on the Internet. What is the (approximate) probability that a randomly selected adult has shopped on the Internet?

\f

According to the cdc, the total blood cholesterol levels in Americansare found to be normally distributed with a mean of 200mg/dl and a standard deviation of of 18mg/dl. Determine the percentage of the population who have blood cholesterol levels less than 210mg/dl. Round to 4 decimal places

Ok which will be the best choice for me to make to buy stapler 22 staplers for $330 or 4 staplers for $80 Help me break this down

Oil Changes. A repair shop believes that people travel more than 3500 miles between oil changes. A random sample of 8 cars getting an oil change has a mean distance of 3375 miles since having an oil change with a standard deviation of 225 miles. At alpha = 0.05, do you have enough evidence to support the shops claim? Show your hand calculations OR

1. The main trial is conducted and involves a total of 200 patients. Patients are enrolled and randomized to receive either the experimental medication or the placebo. The data shown below are data collected at the end of the study after 6 weeks on the assigned treatment. Mean (Std Dev) Systolic Blood Pressure % Hypertensive % With Side Effects

\f

Let f ( x ) = 4 x 2 and > 0. Find a > 0 such that 0 < | x 1| < implies | f ( x ) 2| < . (Select all that apply.) /4 /8 /2 2 Please Explain.

' Mull: I'H wi . ' Unix? " Full 2016)l('llll)ltr 2'), 'MH 6 I'm" I H) mm. Hectiunzz Hhuw ('IHHI'EII wmlt; in In Hu N( )'I' Uru' uny Im'lluulu in it clvnr huw you not your answer. "mm!" "mm: (liuuumnd ::(>,J':xrjn-thi;; cphurrsc. I. Fur g/ '/'(.'If) ['Til , lind ./"(()). - in 2. Use (hp dcf'flfilion of'dcrivntiVC to find f'(:z;) for the func'uon

A distribution center receives shipments of a product from three different factories in the quantities of 50, 3 5 , and 2 0 . Three times a product is selected atrandom, each time without replacement. Find the probability that (a) all three products came from the third factory and (b) none of the three products came from the third factory

MATH 1F92 - Assignment # 4 Due: Friday, Noverm 13, 2015 by 11:00 AM Assignments must have a cover page (refer to the course outline). Please write on one side of the page only and show ALL your work. Answer questions with sentences. Include any printout for a question with the question and clearly label the printout with the question number and

\f

Give examples of two variables that have a perfect positive linear correlation and two variables that have a perfect negative linear correlation. Choose the correct answer below. A. Two variables that have perfect positive linear correlation are the price per gallon of gasoline and the total cost of gasoline. Two variables that have perfect

A database has five tables. A, B, C, D and E. Each of these tables have five attributes/columns. A1, A2 A5. B1, B2, B3 and so on. There are five circumstances listed below. Based on each circumstance determine the best locking method solution and discuss why is it a good solution? 1. Five transactions T1, T2, T3, T4 and T5 access only one table at

Use the probability distribution to find probabilities in parts(a) through(c).The probability distribution of number of dogs per household in a small town Dogs 0 1 2 3 4 5 Households 0.673 0.201 0.079 0.026 0.018 0.003 (a) Find the probability of randomly selecting a household that has fewer than two dogs.(Round to three decimal places asneeded.)

PRINTABLE VERSION Quiz 1 You scored 28.57 out of 100 Question 1 Your answer is CORRECT. Suppose you buy a piece of office equipment for $19,000. After 7 years you sell it for a scrap value of $4,000. The equipment is depreciated linearly over 7 years. The rate of depreciation of the piece of equipment is a) $2,500.00 per year b) $2,714.29 per year

The mean of a normal probability distribution is 60, the standard deviation is 5. What percent of the observations lie between 65 and 75?

Find the following integral Where f(x,y)= x^2+y^2+3

Suppose we select, without looking, one marble from a bag containing 4red marbles and 10 green marbles. What is the probability of selecting a green marble?

how to find all numbers that must be excluded from the domain of each rational expression. 7/x-3

THE BRANCH MANAGER OF AN OUTLET (STORE 1) OF A NATIONWIDE CHAIN OF PET SUPPLY STORES WANTS TO STUDY CHARACTERISTICS OF HER CUSTOMERS. IN PARTICULAR, SHE DECIDES TO FOCUS ON TWO VARIABLES: THE AMOUNT OF MONEY SPENT BY CUSTOMERS AND WHETHER THE CUSTOMERS OWN ONLY ONE DOG, ONLY ONE CAT OR MORE THAN ONE DOG AND/OR CAT. THE RESULTS FROM A SAMPLE OF 70

against the wind a commercial airline in south america flew 1008 miles in 4.5 hours. With a tailwind the return trip took 4 hours. What was the speed of the plane in still air? What was the speed of the wind?

calculate by hand the mean and standard deviation for the binomial distribution with the probability of a success being 3/4 and n=10. Use these formulas mean=np, standard deviation =square root npq

\f

1

A set of observations follow a Normal distribution with mean 40 and standard deviation 4. What proportions of observations have values a)greater than 46 b) less than 34 c) between 34 and 46. Can you explain which number you would use for the value on each instance?

#2 Suppose you are interested in how children with severe autism experienced the receipt of special education assistance in public schools. This population is characterized by underdevelopment of social cognition, social skills, and language skills. How many children should be included in the study? Why? What are the factors considered in making

1.Suppose 34% of respondents to a Gallup poll answered that they were unhappy with their employment. What is the proportion of sample respondents that are unhappy with their employment? 2. The difference in the means of two independent samples has __________ variability than the mean of the differences in a matched-pairs sample. (Assume sample

Case Study: Statistical Thinking in Health Care Read the following case study. Ben Davis had just completed an intensive course in Statistical Thinking for Business Improvement, which was offered to all employees of a large health maintenance organization. There was no time to celebrate, however, because he was already under a lot of pressure. Ben

\f\f

If a student randomly guesses at 15 multiple choice questions, find the probability that the student gets exactly five correct.each question has five possible choices.

would you agree with this analysis? The Standard Deviation of the Population is 15 but the Standard Deviation of the Sample of size 3 = 15/3 = 8.67 Therefore at least one data item in the sample has to be within the range 115 141 (within 3 standard deviations of the mean: 115 + 3*8.67 = 141). The question is "Since there are only 3 data items in

In order to make sure that their bags of chips are of sufficient weight, the Chipper Chip Company try to fill their 7 ounce bags of chips with more than 7.105 ounces. You have been given the task of investigating what proportion of bags produced do have over 7.105 ounces of chips in them. You sample 120 bags and find that the proportion of these

Determine whether the following problem involves a permutation or combination.(It is not necessary to solve theproblem.) How many different 5-letterpasswords can be formed from the lettersHIJ,K,L,M,Nif no repetition of letters isallowed? Answer: Permutation or Combination? Which one.

A survey was run by a high school student in order to determine what proportion of mortgage-holders in his town expect to own their house within 10 years. He surveyed 43 mortgage holders and found that the proportion of these that did expect to own their house within 10 years is 0.54. The student decides to construct a 95% confidence interval for

Running Head: A-CAT CORPORATION 1 A-Cat Corporation Jessica Sand Southern New Hampshire University QSO-510 TRANSFORMER DEMAND ANALYSIS PROJECT Introduction to the Problem My analysis is focused on A-Cat's Corporation need to determine the number of transformers needed to satisfy the demand. The firm had previously relied upon archaic methods in

against the wind a commercial airline in south america flew 192 miles in 2 hours. with a tailwind the return trip took 1.5 hours. What was the speed of the plane in still air? what was the speed of the wind

Question 2: (8 marks)Two types of cordless weed-trimmer batteries are tested. One group of 5 batteries averaged 1.4hours, while the other group consisting of 8 batteries, averaged 1.2 hours.A) What null and alternative hypotheses would you establish to determine whether or not the battery life differs between the two types? (1 mark)B) What test

Littletown Caf Lunch + Dinner Guest Counts by Date Month May June Date 20 21 22 23 24 25 26 27 28 29 30 31 1 2 3 4 5 6 7 * Memorial Day 2012 48 43 57 56 61 73 110 107 112 90 96 91 105 107 105 89 91 96 92 2013 42 40 51 49 71 97 94 95 76 73 81 94 96 87 81 76 83 85 96 2014 58 45 47 80 105 102 110 91 94 91 107 112 89 94 96 99 115 123 96

The Department of Statistics is interested in determining if a significant relationship exists between the GPA of transfer students and their GPA after their first full year in the program a. What statisical test to use? b. What conditions/assumptions need to be verified to properly interpret the results? c. What are the correct null and

Strong earthquakes occur according to a Poisson process in a city with a mean rate of once per 50 years. There are 3 bridges in the city. When a strong earthquake occurs, there is a probability of 0.3 that a given bridge will collapse. Assume the events of collapse between bridges during a strong earthquake is statistically independent. Also, the

match the following types of sampling techniques to their description: 1. A way to select individuals for a study using computer programs or table to identify participants without a known pattern Answer 1 Choose... 2. Selecting individuals for a study using a pattern (e.g. Answer 2 choosing every 15th person to participate) Choose... 3. Within a

[Using both Excel (show your work) and SPSS] A psychologist would like to examine how the rate of presentation affects peoples ability to memorize a list of words. A list of 20 words is prepared. For one group of participants the list is presented at the rate of one word every half second. The next group gets one word every second. The third group

MURD9 Mean Standard E Median Mode Standard D Sample Var Kurtosis Skewness Range Minimum Maximum Sum Count NEG_M9 0 0 0 0 0 0 #DIV/0! #DIV/0! 0 0 0 0 161 Mean Standard Error Median Mode Standard Deviatio Sample Variance Kurtosis Skewness Range Minimum Maximum Sum Count FORCIB9 0 0 0 0 0 0 #DIV/0! #DIV/0! 0 0 0 0 161 Mean Standard E Median Mode

If p = 4/5, what is the smallest value of n that satisfies the requirements for a normally distributed p?

Will cash bonuses speed the return to work of unemployed people? A staate department of labor notes that last year 68% of people who filed claims under a new job in 15 weeks. This year the state offers $500 to people who file claims if they find a job in 15 weeks. The percent rises 77%. Wat flaw in he desing makesi impossible to say whether the

I have a dataset of patients (n=730) who attended an outreach service and completed a survey, looking at ownership of assets and dwelling characteristics. If we would now like to follow-up a sub-set from the sample, to see if the self-reported responses are identical to what we observe at the household level, I have been told the kappa inter-rater

Think about one small data set that you would like to compare to a proposed mean. For example, you could compare the mean weight of a bag of chocolate chip cookies to the mean that the industry claims. Clearly outline your null and alternative hypothesis statements. Consider why your research question is important. Outline how you would use each

Suppose the scores on an examination are normally distributed with a mean of 50 and a standard deviation of 10. 1) What is the probability that the score of a student will be higher than 60? 2) what proportion of the students score below 30? 3) What is the z score that corresponds to the score 44? 4) What is the raw score that corresponds to z=1.5?

***PLEASE PROVIDE ALL EQUATIONS AND ANSWERS, PLEASE SHOW PROOF, THANK YOU 10.57The Computer AnxietyRating Scale (CARS) measures an individuals level of computer anxiety, on ascale from 20 (no anxiety) to 100 (highest level of anxiety). Researchers at MiamiUniversityadministered CARS to 172 business students. One of the objectives of the studywas

\f\f\f

\f\f\f

Department of Economics Ohio Wesleyan University Delaware, OH Economics 251 Research Methods Fall 2015 Daniel Kidane Midterm Exam II This exam is 50 points and will count 15% of your final grade. It consists of two parts and you will have 50 minutes to complete the exam. Part I: Problem Solving Questions Part II: Multiple Choice Questions 1

Problems 11-13 will use the KidsFeet data from the mosaicData package. We will look at the variables length, which is the length of the longer foot (in cm), and width, which is the width of the longer foot (in cm). Let the explanatory variable be length and response variable be width. 11. What is the correlation coefficient of this data? a.

A battery manufacturer wants to estimate the average number of defective (or dead) batteries contained in a box shipped by the company. Production personnel at this company have recorded the number of defective batteries found in each of the 2000 boxes shipped in the past week. 3. What sample size would be required for the production personnel to

Previous Problem List Next (1 point) The solution to the Initial value problem a:" -I- 2m' + 50m = 6cos(3t), az(0) : O, 33'(0) = 0 is the sum of the steady periodic solution msp : Ccos(wt - a)and the transient solution mtr. Find both mw am wa. msp = (108)/(1717(S"2+9))+2465/(1717(s"2+9))-(600)/(1717(s"2+2s+50)-(2468)/(1717(s"2+ ' " zur = (6 e"(-t)

\f Scanned by CamScanner

Mall security estimates that the average daily per-store theft is no more than $250, but wants to determine the accuracy of this statistic. The company researcher takes a sample of 64 clerks and finds that =$252 and s = $10. a) Test at = .05 b) Construct a 90% CIE of

A study of voting chose 663 registered voters at random shortly after an election. Of these72% said they had voted in the election. Election records show that only 56% of all registered voters voted in the election. The boldface number (that is, 72%)is a parameter sampling distribution statistic

Answer the following.... A) How are expected frequencies computed for goodness-of-fit tests? 1. Divide the proportion of the sample size for each category by the total sample size. 2. Divide the total sample size by the sample size for each category. 3. Take the proportion of the sample size for each category from the observed data. 4. Take the

Use the following pairs of observations to construct an80% and a98% confidence interval for beta 11. x 0 5 3 1 4 2 6 y 1 6 2 1 3 4 9 The 80% confidence interval is ----.(Round to two decimal places asneeded.) The98% confidence interval is-----.(Round to two decimal places as needed.)

An engine is tested by means of a water brake at 1000 rpm. The measured torque of the engine is 10000 mN and the water consumption of the brake is 0.5 m3/s, its inlet temperature being 20C. Calculate the water temperature at exit, assuming that the whole of the engine power is ultimately transformed into heat which is absorbed by the cooling water

How do I do this problem? HELP~ How much do wild mountain lions weigh? Adult wild mountain lions (18 months or older) captured and released for the first time in the San Andres Mountains gave the following weights (pounds): 70 100 132 125 60 64 Assume that the population of x values has an approximately normal distribution.(a) Use a calculator

Ma 221 - Differential Equations Homework 4 Name (Printed): Due: Oct 6, 2016 Recitation: Collaborators: I pledge my honor that I have abided by the Stevens Honor System. Sign: General Instructions: Write up solutions to the following set of questions and submit in recitation on the date indicated. Please staple this cover sheet to your solution

Self Esteem Data Marital Status Length of Work (months) Support Level Education (years) Age Self Esteem Single 4 None 9 52 2 Single 4 None 9 52 2 Single 14 Direct 11 40 3 Single 10 Direct 9 46 3 Single 12 None 12 40 3 Single 6 None 10 47 3 Single 4 None 10 50 3 Single 5 None 10 44 3 Married 9 Direct 9 46 3 Married 4 None 9 47 3 Married 4 None 10

Skepticism, self interest, and two-way ANOVA: A study on motivated skepticism examined whether participants were more likely to be skeptical when it served their self-interest. Ninety three participants completed a fictitious medical test that told them they had high levels of a certain enzyme, TAA. Participants were randomly assigned to be told

Practice Quiz 10, November 29, 2016 Name: Please complete this quiz by Saturday, Nov.3, 9 p.m. 1. Twenty five adult citizens of the U.S. were asked to estimate the average income of all U.S. households. The mean estimate was x-bar = $45,000 and s = $15,000. (Note: the actual average household income at the time of the study was about $68,000.)

How do you find the standard deviation of a set of numbers?

10.Research suggests that romantic background music increases the likelihood that a woman will give her phone number to a man she has just met (Guguen & Jacob, 2010). In the study, women spent time in a waiting room with background music playing. In one condition, the music was a popular love song and for the other condition the music was a

\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f

: A bedsheet supplier and a large motel system have decided to evaluate units in lots of 1000 using an AQL of 1.0% with a probability of nonacceptance of 0.10. Determine sampling plans for c = 0, 1, 2, and 4. How would you select the most appropriate plan? [If the last digit of your 800 numbers is ODD number; for example: 800xxxxx1]

Using SPSS, demonstrate that the standard deviation of a set of scores can vary without changing the mean.

1. Assume you need to build a confidence interval for a population mean within some given situation. Naturally, you must determine whether you should use either the t-distribution or the z-distribution or possibly even neither based upon the information known/collected in the situation. Thus, based upon the information provided for each situation

2. A quiz in a statistics course has 10 multiple choice questions, each with five-possible answers. Allison has not studied for the quiz. She has no idea of the correct answer to any of the questions and decides to guess at random for each. Allison is interested in how many questions she gets correct. Describe how this situation follows all of the

1........................................... 2............................. 3............................................. 4.................... 5................ 6........................ 7

m .::....:.:...5 2525555.32353 in -"-IN n. l .a a ', ,':' fl 3 IIIIX, ""n-4 "..I: l...'.... u.;::.xx- lilaxlxxxl xlxxxlxlxll w.)x.......xu- ux..x'......., '.-.'xx'.u.:::-- '"'..'..'....'.- xxx'.'..'.x'r'x....' -,--,:aux..-"."..l.... shadard normal find the specified shaded am under the

A study at a college on the west coast reveals that, historically, 45% of the students are minority students. If random samples of size 75 are selected, 80% of the samples will have less than ________% of minority students.

SHOW ALL WORKING 1. Consider the hypothesis test given by: H0 : p = 0.5 H1: P < 0.5 a random sample of 625 subjects, the sample proportion is found to bepp 0.55. (a) Determine the test statistic. Show all work; writing the correct test statistic, withoutsupporting work, will receive no credit. (b) Determine the Pvalue for this test. Show all work;

Recent research published by Frumin and colleagues (2011) in the journalScienceaddresses whether females' tears have an effect on males. Imagine that exposure to tears lowered self-rated sexual arousal by 1.27 points, with a margin of error of 0.32 points. The point estimate is ________, while the interval estimate is ________.

A small population of N has values of 2, 2, 3, 4, 4, 7, 8, 8, 8, 9, 12, 12. Take 3 samples (preferably random) of size 5 and calculate the mean and standard deviation for each

2 1. Define zero and first order Markov models for the sequence (seqeuence1_A2) provided in the course content. Sequence1_A2 is Mycobacterium tuberculosis gene mtb48 (15 pts) Sequence: ggacgaattggacccgcatgtcgcccgggcgttgacgctggcggcgcggtttcagtcggccctagacgggacgctcaatcagatgaacaacggatcc ttccgcgccaccgacgaagccgagaccgtcgaagtgacgatcaatgggcacca

Jodi poured herself a cold soda that had an initial temp of 35 degrees F and immediately went outside to sunbathe where the temp was a steady 96 degrees F. After 4 minutes the temp of the soda was 45 degree F. Jodi hadto run back into the house to answer the phone. What is the expected temp of the sod after an additional 15 minutes?

Question: (a) Superior Construction Pte Ltd is a successful company dealing with many major projects in Singapore. Recently, it has submitted its biddings for two major Government projects. Projects A worth about $120 million and the company believes it has 40% chance of securing the projects. Project B worth $1.8 billion and there is 30% chance

1. A crossover trial is conducted to compare an experimental medication for migraine headaches to a currently available medication. A total of 50 patients are enrolled in the study and each patient receives both treatments. The outcome is the time, in minutes, until the headache pain resolves. Following each treatment, patients record the time it

1. ABC Manufacturing has a policy that it will reject a shipment of parts from its supplier if inspectors find any defective parts in a random sample of 4 parts from the shipment. The supplier has been in business many years and has a long-term defective rate for parts of 8.3%. 2. What is the probability that a shipment will be rejected after a

15ProbHw2.pdf A hiker starts by taking one of n available trails, denoted 1, 2, . . . , n. An hour into the hike, trail i subdivides into 1 + i subtrails, only one of which leads to the hikers destination. The hiker has no map and makes random choices of trail and subtrail. What is the probability of reaching the destination?

In addition to age grouping information, the audiences interviewed were also asked if they had seen the movie before (Never, Once, More than Once). The two-way contingency table shows the results. under 6 6 to 9 10 to 14 15 to 21 over 21 never 39 60 84 16 151 once 3 20 38 2 15 more than once 3 3 32 0 4 Find the marginal distributions of their

A construction company submits bids for two projects. Listed here are the profit and the probability of winning each project. Assume that the outcomes of the two bids are independent. ProfitChance of Winning BidProject A$75,000.50Project B$120,000.65(a) List the possible outcomes (win/not win) for the two projects and find their probabilities.(b)

\f

Q2: In filling bags of nitrogen fertilizer, it is desired to hold the average overfill to as low a value as possible. The lower specification limit is 22.00 kg (48.50 lb), the populations mean weight of the bags is 22.73 kg (50.11 lb), and the population standard deviation is 0.80 kg (1.76 lb). What percentage of the bags contains less than 22 kg?

A cereal company makes a cereal from two ingredients: wheat and oats. Each ingredient provides two essential nutrients: vitamin A and vitamin B. The company wants to know how many ounces of wheat and oats to include in each box of cereal so that the minimum requirements of 50 milligrams of vitamin A and 15 milligrams of vitamin B are satisfied. An

Showing 800 - 900 of 1503
  • 9 / 16