Second letter U C A G UUUl UCU UAU ITYT UGUI.cys UUCJ Phe UCC UAC UGC U UCA Ser UUA LOU UAA Stop UGA Stop UUG UCG UAG Stop UGG Tip CUU CCUT CAU His CGU CUC CCC CAC OGC C CUA Leu CCA Pro CAA Ich CGA Arg CUG CCG CAG CGG Third letter First letter AUU ACU AAU AS AGU Ser AUC ACC AAC J AGC J AUA ACA Th AAA LLYS AUG Met ACG AAG } AGA LArg AGG J GUU GCU GAUL ASP GGUY GUC GAC Val GCC GGC QOC GUA GCA Aln GAALGI GGA IGly GUG GCG GAGJ GGG Use the genetic code to describe the sequence of amino acids that would be translated from the DNA sequence below. The strand below is the template strand. This DNA segment contains the beginning of the open reading frame. 5'AATGTGTTAAGACGTGCAGTACATT 3' a. What is the mRNA sequence? b. What is the sequence of amino acids translated