Question: Solve this easy amd simple 7. Return the triplet to its onginal state (ATG). Now place an additional A after the G. your strand will
Solve this easy amd simple
7. Return the triplet to its onginal state (ATG). Now place an additional A after the G. your strand will read ATGA. ATGACCAGGCGGCGAGAGCTAA Check the new protein created by your new DNA White the new amino acid chain. 8. Return the triplet to its original state (ATG). Now change the second triplet from CCA to CCC. New sequence: ATGCCCGGCGGCGAGAGCTAA Check the new protein created by your new DNA. List the sequence of the new protein: Final Analysis - There are three mutations you explored in this activity. You can use what you observed in the activity to help you answer the questions or search other sources if you are still confused. 9. First, you created a POINT mutation in your DNA. Describe what a point mutation is and how this can affect the protein created by the gene. 10. The second mutation you explored is called a FRAMESHIFT mutation. Explain what this means and how it affects the protein. 11. The third mutation you explored is a special kind of point mutation called a SILENT mutation. Explain what this means. 12. Compare the different types of mutations. Which type will have the greatest effect on the outcome of protein? wwwww.biologycorner.comStep by Step Solution
There are 3 Steps involved in it
1 Expert Approved Answer
Step: 1 Unlock
Question Has Been Solved by an Expert!
Get step-by-step solutions from verified subject matter experts
Step: 2 Unlock
Step: 3 Unlock
