Weber's law, a concept taught in most Introduction to Psychology courses, states that the ratio of...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
Weber's law, a concept taught in most Introduction to Psychology courses, states that the ratio of the intensity of a stimulus to the "just noticeable" increment in intensity is constant, that is, the ratio doesn't depend on the intensity of the stimulus. The ratio is called the "Weber fraction," so a concise statement of Weber's law is that "the Weber fraction is constant, regardless of the stimulus intensity." It turns out that Weber's law is not so much a law as it is a rule of thumb, since it is violated in many situations. For instance, for some auditory stimuli, the Weber fraction does depend systematically on the stimulus intensity. The following bivariate data are the experimental data obtained for one listener in an auditory intensity discrimination task. For each of the ten stimulus intensities x (in decibels), the Weber fraction y (in decibels) is shown. Figure 1 is a scatter plot of the data. Also given is the product of the stimulus intensity and the Weber fraction for each of the ten stimuli. (These products, written in the column labelled "xy", may aid in calculations.) Stimulus Weber fraction, y intensity, x (in decibels) (in decibels) xy 35 -0.48 -16.8 40 -0.32 -12.8 45 -1.42 -63.9 50 -1 -50 55 -2.18 -119.9 60 -2.93 -175.8 65 -3.15 -204.75 Stimulus intensity (in decibels) 70 -3.13 -219.1 75 -4.2 -315 Figure 1 80 -4.09 -327.2 What is the sample correlation.coefficient for these data? Carry your intermediate computations to at least four decimal places and round your answer to at least three decimal places. (If necessary, consult a list of formuias.) Weber fraction (in decibels) Weber's law, a concept taught in most Introduction to Psychology courses, states that the ratio of the intensity of a stimulus to the "just noticeable" increment in intensity is constant, that is, the ratio doesn't depend on the intensity of the stimulus. The ratio is called the "Weber fraction," so a concise statement of Weber's law is that "the Weber fraction is constant, regardless of the stimulus intensity." It turns out that Weber's law is not so much a law as it is a rule of thumb, since it is violated in many situations. For instance, for some auditory stimuli, the Weber fraction does depend systematically on the stimulus intensity. The following bivariate data are the experimental data obtained for one listener in an auditory intensity discrimination task. For each of the ten stimulus intensities x (in decibels), the Weber fraction y (in decibels) is shown. Figure 1 is a scatter plot of the data. Also given is the product of the stimulus intensity and the Weber fraction for each of the ten stimuli. (These products, written in the column labelled "xy", may aid in calculations.) Stimulus Weber fraction, y intensity, x (in decibels) (in decibels) xy 35 -0.48 -16.8 40 -0.32 -12.8 45 -1.42 -63.9 50 -1 -50 55 -2.18 -119.9 60 -2.93 -175.8 65 -3.15 -204.75 Stimulus intensity (in decibels) 70 -3.13 -219.1 75 -4.2 -315 Figure 1 80 -4.09 -327.2 What is the sample correlation.coefficient for these data? Carry your intermediate computations to at least four decimal places and round your answer to at least three decimal places. (If necessary, consult a list of formuias.) Weber fraction (in decibels)
Expert Answer:
Related Book For
Posted Date:
Students also viewed these mathematics questions
-
(a) In Figure show that the ratio of the Hall electric field magnitude E to the magnitude EC of the electric field responsible for moving charge (the current) along the length of the strip is E/EC =...
-
CAPM Using the CAPM, show that the ratio of the risk premiums on two assets is equal to the ratio of their betas.
-
Using the CAPM, show that the ratio of the risk premiums on two assets is equal to the ratio of their betas.
-
A company issues a callable (at par) ten-year, 7% coupon bond with annual coupon payments. The bond can be called at par in one year after release or any time after that on a coupon payment date. On...
-
A 180-day note dated September 14, 2016, is made at 5% for $1665. What is the present value of the note on October 18, 2016, if money is worth 6%?
-
What does it mean to take a long-term perspective with respect to structuring a deal?
-
True or false: Zero to peak and peak readings are the same thing.
-
During its first year of operations, Benji Corporation had the following transactions pertaining to its common stock . Jan. 10 Issued 70,000 shares for cash at $5 per share. July 1 Issued 40,000...
-
After reviewing the Alberta Child and Youth Family Enhancement Act (CYFEA). Please read the following scenarios, and discuss them, as if they were occurring here in Alberta and you were the...
-
A double-wall heat exchanger is used to transfer heat between liquids flowing through semicircular copper tubes. Each tube has a wall thickness of t = 3 mm and an inner radius of r; = 20 mm. and good...
-
d) For die casting processes: 1. What are the most common metals processed using die casting and discuss why other metals are not commonly die casted? 2. Which die casting machines usually have a...
-
An advantage of translesion-replicating polymerases is that they can replicate _________________, but a disadvantage is that they _________________. a. very quickly, have low fidelity b. over damaged...
-
In one PCR cycle, the correct order of steps is a. primer annealing, primer extension, denaturation. b. primer annealing, denaturation, primer extension. c. denaturation, primer annealing, primer...
-
If an abnormal repressor protein could still bind allolactose but the binding of allolactose did not alter the conformation of lac repressor, how would the expression of the lac operon be affected?
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
Following the infection of healthy tobacco leaves by reconstituted viruses, what two characteristics did Fraenkel-Conrat and Singer analyze? Explain how their results were consistent with the idea...
-
During 2018, Anne Teak got divorced. In 2023, she presents the following information: Wages earned of $61,986 Alimony received of $8,400 Lawsuit proceeds for lost wages of $11,988 Interest received...
-
Willingness to pay as a measure of a person's value for a particular good measures the maximum a person would be willing to pay requires that payment actually be made depends on the satisfaction that...
-
Use the data in Appendix 3 to calculate the equilibrium constant for the reaction Agl(s) Ag+(aq) + I2(aq) at 25C. Compare your result with the Ksp value in Table 16.2.
-
Classify each of the following species as a weak or strong base: (a) LiOH, (b) CN-, (c) H2O, (d) ClO4-, (e) NH2-.
-
A 0.450-g sample of steel contains manganese as an impurity. The sample is dissolved in acidic solution and the manganese is oxidized to the permanganate ion MnO4-. The MnO4-ion is reduced to Mn2+ by...
-
(a) During a certain day the outdoor temperature ranges between \(60^{\circ} \mathrm{F}\) and \(80^{\circ} \mathrm{F}\). What is the corresponding range in degrees Celsius and in kelvins? (b) The...
-
Which is greater in each pair: (a) the thermal energy of a pool of water or that of a glass of water at the same temperature, (b) the heat capacity of a pool of water or that of a glass of water at...
-
Which of the following systems undergo a quasistatic process? (a) A gas-containing balloon is popped inside a vacuum container. System: container, gas, and balloon. (b) A cup of coffee cools down....
Study smarter with the SolutionInn App