This question asks you to find the palindromic segment with a certain length from a DNA string.

e.g. Given a DNA sequence: TGATGACGTGACAGATGATG.

If asked to find the palindromic segments with four nucleotides, the result should return the natural position starting at 6 and the segment itself ACGT. (Shown in the sequence with bolded characters.)

So, the answer should be filled in:

6, ACGT

Here is a longer DNA sequence, and you are asked to find a palindromic segment with ten nucleotides.

The sequence is:

TAACTATTTCGGCACGGCATGCAACCTAAGGAAAGAAGCAATTGCCTGAACAGTGACGAGATTATTCCGTGATCTATTACGTGTCACGCACCACAGAGCCCCCGGGTCAAGCAAGGGGGGGGAATAGGTAACTGGTTGGGGTACCCCCTTCGGTGTTAGCAATCGGGGGTGCTTCTATCTATGCAGTAAGGTGCCGCCAA

Circle or box your answer by following the format mentioned above.