Question: Total points: 15 Write a python program to search for occurrences of a pattern in a given dra sequence e.g. pattern = gag dna =

Total points: 15 Write a python program to search for occurrences of a pattern in a given dra sequence e.g. pattern = "gag" dna = "taaggaccccatgccctcgaataggcttgagcttgagcaattaacgcgcacgegctggccgescgtataagccaaggtghagtgaggttgcattatacatgccegcttgtgattaacgcatgce ataggacgsttaggctcagaacccgcaaccaatacacgtgattitctcgteccctg Based on the above example the output should indicate how many instances of the pattern are in the string and in what positions: gag found at position 29 gag found at position 35 gag found at position 84

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

(a) In SystemVerilog, what is the difference between: (i) The ternary operator ? and if...then...else statements? [2 marks] (ii) always_ff and always_comb? [2 marks] (iii) Blocking, non-blocking and...

Portray in words what transforms you would have to make to your execution to some degree (a) to accomplish this and remark on the benefits and detriments of this thought.You are approached to compose...

Briefly describe ASCII and Unicode and draw attention to any relationship between them. [3 marks] (b) Briefly explain what a Reader is in the context of reading characters from data. [3 marks] A...

can someone solve this Modern workstations typically have memory systems that incorporate two or three levels of caching. Explain why they are designed like this. [4 marks] In order to investigate...

Question 1 1.5 pts You have been asked to paint the outside of your house. You have never done this before. You believe that because you painted your room over a year ago, the techniques you used...

answer the question clearly You are building a flight-control system for which a convincing safety case must be made. Would you assign the tasks of safety requirements engineering, test case...

) Consider integer division of one two's-complement binary number by another. Programming languages may vary in the result when one argument is negative. What differing conventions might they be...

Prolog You are approached to compose a Prolog program to work with twofold trees. Your code shouldn't depend on any library predicates and you ought to expect that the mediator is running without...

Jones & Bartlett Learning, LLC. NOT FOR RESALE OR DISTRIBUTION CHAPTER Hot Spot Analysis 10 LEARNING OBJECTIVES C A R R Provide a working definition of a \"hot spot.\" , Be able to explain different...

lup ] (d) Show how a generating (or "mother") wavelet (x) can spawn a family of "daughter" wavelets jk(x) by simple shifting and scaling operations, and explain the advantages of representing...

Winter Consulting, from Problem 4-2A, prepared an end-of-period spreadsheet (work sheet) at December 31, 2015, the end of the current fiscal year (shown below). Instructions 1. Prepare an income...

Mike, Rosie and Shobber live in separate houses on a dark and windy road.The following represent marginal benefits for streetlights: MB Mike = 200-2Q M MB Rosie = 100- QR MB Shobber = 100-2Q S where...

Which of the following transactions would NOT be counted as a balance of payments ( BOP ) transaction from the US perspective? Group of answer choices A US company pays the salaries of its executives...

5. Develop a scenario comparing two PH programs and involving the use of a CBA.

1. What particularly intrigues you about this innovation? Why do you think it is needed and might or might not work in your community?

2. In what ways might the innovation be adapted to your particular community characteristics or needs?

1. What are the major sources of stress in your life? What are the major sources of stress at work? Write down three sources of stress for which you can take some sort of action to change.