Unequal genetic exchanges can generate duplications and deletions (chose the best answer) Select one: O A....
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
Unequal genetic exchanges can generate duplications and deletions (chose the best answer) Select one: O A. Both a duplication and a deletion can be created by the same event O B. Deletions never involve coding sequences O C. Deletions are typically advantageous because they reduce the size of chromosomes O D. Duplications never involve coding sequences O E. A deletion on one chromosome is always associated with a duplication on the homologous chromosome Unequal genetic exchanges can generate duplications and deletions (chose the best answer) Select one: O A. Both a duplication and a deletion can be created by the same event O B. Deletions never involve coding sequences O C. Deletions are typically advantageous because they reduce the size of chromosomes O D. Duplications never involve coding sequences O E. A deletion on one chromosome is always associated with a duplication on the homologous chromosome
Expert Answer:
Answer rating: 100% (QA)
Duplication is a type of chromosomal anomaly where a fragment of the chromatid co... View the full answer
Related Book For
Posted Date:
Students also viewed these biology questions
-
On rare occasions, a chromosome can suffer a small deletion that removes the centromere. When this occurs, the chromosome usually is not found within subsequent daughter cells. Explain why a...
-
The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...
-
The homologous chromosomes align independently at the equator during meiosis so a. All possible combinations of alleles can occur in the gametes. b. Only the parental combinations of gametes can...
-
Ice Cool produces two different models of air conditioners. The activities, costs, and cost drivers associated with the production processes follow. Budgeted Activity Usage 7,600 Activity Machining...
-
The purchases journal of NorthEastern Publishing Company follows. Requirements 1. Total each column of the purchases journal. 2. Open four-column ledger accounts for Merchandise Inventory (118),...
-
Carter owns 1,200 shares of Echo Corporation stock. He purchased 400 shares of the stock on December 23, 2014 for $48,000, and the other 800 shares on October 31, 2015, for $84,000. On August 14,...
-
In which cycle does a company ship goods to customers? a. production cycle b. financing cycle c. revenue cycle d. expenditure cycle
-
Maine Construction builds office buildings. The buildings generally cost between $ 5 million and $ 8 million to build, and the plumbing can cost between $ 300,000 and $ 600,000 depending on the...
-
34. Budgeting for Cash Collections and Cash Payments. Hershel's Chocolate produces chocolate bars. The treasurer at Hershel's Chocolate is preparing the cash budget and would like to know when cash...
-
Phil Williams and Liz Johnson are 60% and 40% partners, respectively, in Williams & Johnson Partnership. Their beginning basis is $33,000 for Phil and $31,000 for Liz. The partnership had the...
-
Which term accurately describes Agile and DevOps? a suite of software applications a set of automated tools a set of processes a set of values and principles I don't know this yet.
-
Boyle Ltd expects to receive $8,000 at the end of every year for a total of 6 years. If Boyle Ltd earns 7% on its investments, what is the present value of these future cash receipts?
-
Purpose(s): Identify shifting landscape in Business and Business Communication Demonstrate importance of communication in a 21st Century Business Environment Instructions for this Discussion For this...
-
What is the role of feedback in improving business writing? Describe a method for effectively incorporating feedback into the revision process without compromising the writer's voice or intent .
-
1. What were the bid price, asked price, and yield to maturity of the 5.000% (May 15th, 2037) Treasury bond displayed in Figure below? What was its asked price the previous day? If 30 days have...
-
Mr. Akika has 30 23-cent and 33-cent stamps all told The stamps are worth $8.70. How many of each kind of stamp does he have? Mr. Akika has 23-cent stamps and 33-cent stamps
-
(b) Find the sum of the following series n=0 (1)" (2n + 2)+1 (2n+1)!24n-
-
Provide a few individual examples who revealed what aspects of emotional intelligence?
-
Why might government provision of insurance lead to a larger number of insurance claims than private provision of insurance would?
-
Suppose that a state mandates that both women and men be provided family leave by their employers following the birth of a child. a. How would you empirically test how this policy change affected the...
-
Think back to Chapter 5. Why can the public good provision problem be thought of as an externality problem?
-
IFRS and the CPA Canada Handbook, Part II, have equal status in Canada for financial reporting.
-
Any Canadian company that uses U.S. GAAP must prepare its statements in U.S. dollars.
-
In a private corporation, the needs of external users have no impact on the companys financial reporting objectives.
Study smarter with the SolutionInn App