Question: Unit 4 Evaluation Thinking 10. A line is parallel to the line y = -;x + 9 and passes through the point of intersection of

Unit 4 Evaluation Thinking 10. A line is parallel to the line y = -;x + 9 and passes through the point of intersection of x + y = 10 and 3x - 4y + 12 =0. Determine the equation of the line.Unit 4 Evaluation 7. The line y = -3x + 7 is a line of best fit to various data points. Graph possible data points the line of best fit is close to. What R value could this line have

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Mathematics Questions!

1. Solve the following inequalities. a. 11x+62 14x+3 b. 4x-2 -6

1. The vector starts at the point and ends at the point (a) The component form of this vector is , (b) Compute the magnitude (c) The unit vector parallel to Note: to enter a vector 2. Suppose vectors...

Without Loops/conditions execute a Java program that prints the following output. the numbers shown in the output should not be hardcoded (should not be written manually when printing), you should...

bp = YA Once you get the equation of the perpendicular line, you need to calculate the coordinates (x, y) of the intersection point between the original line and the perpendicular one as follows....

Collecting and Analyzing Diagnostic Data at Alegent Health The two applications in Chapter 4 described the cal area, while others produced visions that were entry and contracting processes at the...

help with the questions below Part A Consider the function f(x) = x3- 4x2 + 2. Calculate the limit of the difference quotient at x0 = 3 for f(x). Answer: Space used (includes formatting): 0 f 15000...

1.Do heavier cars really use more gasoline? Suppose a car is chosen at random. Let x be the weight of the car (in hundreds of pounds), and let y be the miles per gallon (mpg). In the least-squares...

Lines & Planes 8 K/U 13 Comm 10 Think Unit 6 Test 12 App Name ________________________________ Knowledge/Understanding (8 marks) Identify the choice that best completes the statement or answers the...

Algebraic For the following exercises, determine whether the lines given by the equations below are parallel, perpendicular, or neither parallel nor perpendicular: 4x7y= 10 7x+4y=1 3y+x= 12 y= 8x+1...

What peptide would be synthesized from the following DNA sequence? 5TTACCGACTGGTCACTCCCAT3

The Sports Equipment Division of Brandon McCarthy Company is operated as a profit center. Sales for the division were budgeted for 2010 at $900,000. The only variable costs budgeted for the division...

The nominal interest rate is 7 % and the expected inflation rate is 2 % Based on the Fisher effect the real rate of interest is 5 . 0 0 x 5 . 1 % 4 0 %

Kilmer Company has demand for its only product that exceeds its manufacturing capacity. The company provided the following information for the machine whose limited capacity is prohibiting the...