Using PERL syntax/programming.

Write a script that uses nested loop constructs to print the multiplication tables up to 12. Sample output:

1 2 3 4 5 6 7 8 9 10 11 12 2 4 6 8 10 12 14 16 18 20 22 24 3 6 9 12 15 18 21 24 27 30 33 36 4 8 12 16 20 24 28 32 36 40 44 48 5 10 15 20 25 30 35 40 45 50 55 60 6 12 18 24 30 36 42 48 54 60 66 72 7 14 21 28 35 42 49 56 63 70 77 84 8 16 24 32 40 48 56 64 72 80 88 96 9 18 27 36 45 54 63 72 81 90 99 108 10 20 30 40 50 60 70 80 90 100 110 120 11 22 33 44 55 66 77 88 99 110 121 132 12 24 36 48 60 72 84 96 108 120 132 144 

(Don't worry if you can't get things to line up neatly like that; if you're deeply bothered by nonalignment, perldoc -f printf and perldoc -f sprintf.)

(5 pts)

Write the script from the previous question as a function that takes an argument for the size of the matrix. So that:

print mult_table( 5 ); 

would produce

1 2 3 4 5 2 4 6 8 10 3 6 9 12 15 4 8 12 16 20 5 10 15 20 25 

(Again, don't worry about getting things to line up correctly.)

(5 pts)

Write a script to generate random DNA sequences of a given length.

$ ./random.pl AAACGCAAGGGTATGTATAACAAGGCTTGCTCGATGTTGGAAGGGTGGAC 

(5 pts)

Rewrite the script from the last question as a function, taking an argument for the length of the sequence that is returned. Write the function such that a second, optional argument, if provided, will cause the function to produce a sequence of a random length between 1 and the first argument.

(5 pts)

Use the program from the previous problem to generate 10 random DNA sequences of at least 50 bases. Save them in 10 distinct files (don't forget to remove any header you added). Write a program that prints the names of the files that contain sequences that have at least one run of four identical bases in them.

$ ./base_find.pl T run found in ./seq2 G run found in ./seq4 T run found in ./seq6 G run found in ./seq7 T run found in ./seq8 

(5 pts)

Write a regexp debugger: Code which asks for a regular expression, then tests inputs against that regular expression and reports whether or not they match. It should also support an 'exit' command to allow quitting. Sample output:

$ ./regexp_debug.pl Enter regexp: oo Enter string or 'exit' to exit; foo Match! Enter string or 'exit' to exit; bar No match! Enter string or 'exit' to exit; exit bye bye! 

(10 pts)