Using Python: 1. Write a function called 'back_trans' that takes an RNA sequence as an argument and returns the original DNA sequence. For example, if the RNA sequence is: uaguacua Then the backwards transcribed DNA sequence should be: tagtacta Write a program to prompt the user to enter an RNA sequence and validate the sequence using the function you wrote in lab 5 and display the original DNA sequence. 2. Write a function called 'gc_percent' that takes a DNA sequence as an argument and returns the percentage of the sequence that are 'G' or 'C' nucleotides. For example, if the DNA sequence is: tagtacta Then the function will return 0.25. For this problem, your program must read the DNA sequence from a file called "fasta.txt". The contents of the file are: >monkey tatagctacgtagcaatagcgccgatacg