Question: We are given the same short DNA sequence of the previous problems: ACTGATCGATTACGTGAATTCATAGTATATCATACATATATATCGATGCGTTCAT The sequence contains a recognition site for the EcoRI restriction enzyme, which

We are given the same short DNA sequence of the previous problems: ACTGATCGATTACGTGAATTCATAGTATATCATACATATATATCGATGCGTTCAT The sequence contains a recognition site for the EcoRI restriction enzyme, which cuts at the motif G*AATTC (the position of the cut is indicated by an asterisk). Write a program, named fragment_lengths.py, which will calculate the size of the two fragments that will be produced when the DNA sequence is cut with EcoRI.

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Variety of Piston Containers-Number of Moles 121 The figures below show piston containers with equal cross-sectional areas that contain different volumes of gas. The types of gases and their...

Problem One: Restriction Fragment Lengths( Use Python to solve the problem ) We are given this short DNA sequence: ACTGATGTATAGTAGAATTCCTNNNNNAGGCTATTACATATATATCGATGCGTTCAT The sequence contains a...

Bio informatics PART1: Calculating AT content. Write a program that will write in a file a sentence stating the percentage of GC content of the DNA sequence provided in the file bigdna.txt. PART2:...

1. On November 1, 2020, Jill Luckovich began Jill Luckovich Interior Design Co. with an initial investment of $6,725, and on November 30 her records showed the following (alphabetically arranged)...

6-7; 6-9; 6-12 . I need help with these finance questions. PROBLEM 6-1 Cash provided by operations (CPBO) differs from free cash flow for the following reasons: 1. Solution Legend = Value given in...

I need help with the following assignment: Final Project PART I. I'm attaching the final project rubric, but just the first part needs to be done (PART I). Every single critical element must be...

Year 0 1 2 3 4 5 EBIT Taxes NOPAT Plus: Depreciation Less: CAPEX Less: Net working capital needs (See Note 1) Plus: Salvage value of the fixed assets in year 5 Firm Free Cash Flow (FFCF) Net Fixed...

As one of the accountants for the City of Springfield, you will record the following transactions into the accompanying workbook?sheet GF WS. Note that some transactions have already been recorded in...

Class Activity 1 1. On November 1, 2020, Jill Luckovich began Jill Luckovich Interior Design Co. with an initial investment of $6,725, and on November 30 her records showed the following...

1) The cash flows of a project for a company is given below. (a) Calculate the IRR for this project, (b) suppose that E=MARR = 20% per year. What is the project's ERR, and is the project acceptable?...

Interim financial reports are subject to limitations and distortions. Identify and discuss at least two reasons for this.

Consider a production function and the resource constraint Y = F(K, Lt) = AKO L and the capital accumulation equation Y = C + I + G e G = K Assume there is no population growth, so L = Lt+1= L (2)...

The type of organizational asset / capital that is the most difficult to measure is _ _ _ _ _ _ _ . physical operational financial human

Brandon earns $37,200 per year, and he's paid monthly. His employer offers a 401(k) plan with 75% matching up to 8% of salary. What is the minimum amount of money that Brandon needs to contribute to...

Describe the role of a physician assistant. Would you feel comfortable going to a physician assistant?

Why was managed care developed? Do you think managed care is a good way to provide healthcare services? Why or why not?

What is recruitment? Which is more important, internal or external? Or are both equally important? Defend your answer.