Question: what is a fixed database

what is a fixed database

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

A fixed database typically refers to a database that does not undergo frequent changes or modificati... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Q:

QUESTION 11 Each of the outcomes listed below is a result of executing the following script except for one. Which one? CREATE ROLE ExampleRole; ALTER ROLE db_datareader ADD MEMBER ExampleRole; GRANT...

Q:

Define a simple scenario (in the context of processes and threads in Linux) in which a counting semaphore could be used. Your counting semaphore must NOT be implemented as a binary semaphore and must...

Q:

Mike chooses a DaaS arrangement for his small business because it reduces costs. Why is DaaS less costly than the traditional alterr a . no in - house database installation, maintenance, or...

Q:

Which of the following is not a method used for authentication in databases? Question 3 options: System - wide permissions Database - specific permissions Fixed database roles Autologging

Q:

CASE Background: Sparkling Clean Services (SCS) is a local business in the Tri-cities area. It provides cleaning services to residential households and commercial establishments. Both households and...

Q:

CASE Background: Sparkling Clean Services (SCS) is a local business in the Tri-cities area. It provides cleaning services to residential households and commercial establishments. Both households and...

Q:

Information Systems for Business Building a DSS in Excel The following assignment is intended to be a brief introduction to how a spreadsheet application such as Microsoft Excel may be used as a...

Q:

MGMT 8500: BUDGET ASSIGNMENT - S21 MGMT 8500 BUDGET ASSIGNMENT-521 Overview: In this assignment, you are provided with a case which includes data relating to static budget, flexible budget, and...

Q:

From Page number 3 to Page number 8 is the whole question . On page number 8, all required Excel sheet files are mentioned and all excel sheet files screenshots are also included for reference....

Q:

MGMT 8500H ASSIGNMENTIBI BUDGET ASSIGNMENT-F21 Overview In this assignment, you are provided with a case which includes data relating to static budget, flexible budget, and variance analysis. You...

Q:

Impact of a Discount Berol Corporation sold 20-year bonds on January 1, 2010. The face value of the bonds was $100,000, and they carry a 9% stated rate of interest, which is paid on December 31 of...

Q:

According to The Motorist, a publication of the American Automobile Association, 90% of all calls for emergency service on a cold winter day in Tottenville are for cars tlmt wont start because of a...

Q:

Which of the following statements regarding available for sale debt securities is true ? Question content area bottom Part 1 A . Interest revenue and fair value adjustments are netted to determine...

Q:

Calculating AT content Here's a short DNA sequence: ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT Write a program that will print out the AT content of this DNA sequence (i.e. the proportion...