Which of the following general mechanisms appear to be involvedin the formation of cancer cells? A .

Fantastic news! We've Found the answer you've been seeking!

Question:

Which of the following general mechanisms appear to be involvedin the formation of cancer cells?

A. RNA failure, DNA phosphorylation,phosphorylation of adenyl cyclase

B. inversions, operon formation,methylation

C. transdetermination, mutation, allostericinteractions

D. genomic instability, DNA repair failure,chromatin modifications

E. suppression, tabulation, projection

Related Book For answer-question

Genetics Analysis And Principles

ISBN: 9780073525341

5th Edition

Authors: Robert Brooker

See More Books

Posted Date: Dec 13, 2022 07:00 AM

See More Questions

Which of the following general control activities involves creating program flowcharts? 1. Accessing programs and data 2. Changing existing programs and systems 3. Developing new programs and systems...
Which of the following ions possess a noble gas electron configuration? (a) K+ (d) O- (b) He+ (e) F- (c) H- (f) Ca2+
Which of the following compounds are isomers of spiropentane?
Bill and Mary are married. Mega Corporation employs them both. In 2018, Mary earned $70,000 and Bill earned $135,000, in both cases W-2 wages. How much FICA tax were they required to pay for 2018?
Which of the following companies are likely to have high short-term financing needs? Why? a. A clothing retailer b. A professional sports team c. An electric utility d. A company that operates toll...
What are the five tests that must be met for an individual to be considered a dependent as a qualifying child? as a qualifying relative? Briefly explain each test.
CMS is a claims processing company in Mobile, Alabama. Chastity Jones, a black woman, completed an online employment application for a customer service position with CMS. Jones interviewed with a...
Birmingham Contractors uses a job order costing system. In May 2010, the company made a $3,300,000 bid to build a pedestrian overpass over the beach highway at Gulf Shores, Alabama. Birmingham...
Business Firms have to experience various types of costs in producing their products or in providing their services. Explain the basis of costs classification as "Direct-Indirect" and...
A circle with a radius 3 cm long is inscribed within a square (as shown below) Point A starts at the 3o'clock position and moves CCW along the circle Point B is fixed at the bottom-left corner of the...
Solve the below expression: (3 x 2 + x 3 + 6 + 5 x ) ( x + 1)
Silas is farsighted and wants to read the newspaper. Withoutglasses, Silass near point (the closest point he can see in focus)is far away, so he has to try to read the paper by holding his...
Ellen paid $15,000 of qualified education expenses for an eligible student. Based on those expenses, for what lifetime learning credit would she be eligible, assuming she qualifies in all other...
Consider the following MIPS function. fool: addi Sto Sa0 37 addi St1 Sal-12 sll St2 $t1 2 slt St3 St2 St0 beq St3 $0 a addi Sv0 $0 1 a: jr addi jr Sra $v0 $0 2 Sra. (a) [3 marks] Assuming Sa012 and...
Provide two current rules of accounting for leases. How are the income statement and balance sheet affected by these rules? What method do you think best represents the liabilities and expenses of a...
Could you provide an in-depth analysis of the fundamental tenets of population genetics, encompassing concepts such as genetic drift, gene flow, and the Hardy-Weinberg equilibrium, and elucidate...
Prepare a set of strategies with explanation to improve digital business in the specified industry?
4. Jobe dy -Y 2 et by
In the pedigree shown here for a trait determined by a single gene (affected individuals are shown in black), state whether it would be possible for the trait to be inherited in each of the following...
The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...
What is the purpose of the International HapMap Project? How will it help researchers who study disease-causing alleles?
Enter up a columnar purchases day book with columns for the various expenses for J. Still for the month from the following information on credit items. 2016 January f 1 Bought goods from H. Graham...
A Enter up a columnar purchases day book with columns for the various expenses for F. Graham for the month from the following information on credit items. 2016 June Bought goods from J. Syme 4 Bought...
Enter up the relevant accounts in the purchases and general ledgers from the columnar purchases day book you completed for Review Question 20.4A. Data From Review Question 20.4A 20.4A Enter up a...

Which of the following general mechanisms appear to be involvedin the formation of cancer cells? A .

Question:

Expert Answer:

The correct option is D genomic instability DNA repair failure chromatin modifications The reason fo... View the full answer

Genetics Analysis And Principles

Students also viewed these accounting questions